BBa_I12036 1 BBa_I12036 Modified lamdba Prm promoter (cooperative repression by 434 cI) 2004-08-17T11:00:00Z 2015-08-31T04:07:31Z Bushman, F. D. The bacteriophage 434 right operator roles of O-R1, O-R2, and O-R3. J. Mol. Biol. (1993) 230, 28-40. Released HQ 2013 Lamdba Prm promoter modified to be activated by lamda repressor (cI) and repressed by 434 repressor (cI). Two operators are used for both activation and repression to enhance cooperativity. false false _3_ 0 103 7 In stock false The O-R3 site of lambda (17 nt) was replaced by the O-R1 site of 434 (14 nt) to facilitate repression by 434 cI. The new 434 O-R1 is 5'-justified with the lambda O-R3 it replaced, leaving the -10 sequence intact. The 434 O-R2 site replaces the wildtype labmda promoter starting at -5, thereby preserving the 8 nt between 434 O-R1 and O-R2 in the wildtype. The mRNA transcript will contain an additional 9 nt compared to wildtype lambda phage. true Hans annotation1062203 1 start range1062203 1 83 83 annotation1056738 1 OR2 434 range1056738 1 78 91 annotation1056740 1 -10 range1056740 1 71 76 annotation1056736 1 OR2 lambda range1056736 1 33 49 annotation1056737 1 OR1 434 range1056737 1 56 69 annotation1056739 1 -35 range1056739 1 48 53 annotation1056735 1 OR1 lambda range1056735 1 9 25 BBa_I12036_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagatttacaatgtatcttgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z