BBa_I12212 1 TetR-4C TetR - TetR-4C heterodimer promoter (negative) 2004-08-05T11:00:00Z 2015-08-31T04:07:31Z This promoter is repressed by a heterodimer of wild-type TetR and mutant TetR-4C. It differs from wild-type TetR promoter in that the +4 and -4 regions of its O2 binding site have been changed, and the -35 region of the reverse promoter (pA) has been destroyed. false false _3_ 0 120 7 Not in stock false The O2 and O1 mutations are all single point mutations, occuring at the first base which appears listed here. false rwald annotation1031337 1 -35 range1031337 1 1 6 annotation1031338 1 TetR O2 range1031338 1 2 20 annotation1031339 1 -35 range1031339 1 22 27 annotation1057574 1 O1 mutation range1057574 1 37 37 annotation1031342 1 -10 range1031342 1 45 50 annotation1057573 1 O2 mutation range1057573 1 7 7 annotation1031340 1 -10 range1031340 1 26 30 annotation1031341 1 O1 range1031341 1 32 50 BBa_I12212_sequence 1 ttctctgtcactgatagggagtggtaaaataactctgtcaatgatagagtggattcaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z