BBa_B0040 1 spacer Spacer.1 (generic) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Randomly generated and optimized for several parameters (see Design notes). Released HQ 2013 Generic spacer for ensuring a 70 bp distance between the end of the suffix of the BioBrick part containing the double terminator and the prefix of the BioBrick part containing the promoter of the new gene. Please, use the AlignX function of Vector NT to check for homology with the components in your plasmid before using this spacer.</P> false false _1_ 0 24 7 In stock false <P> <P><p>The size of the spacer was choosed to meet the minimum length of a sequence that can be queried using the BLAST search engine. However, subsequences of it can be used to design shorter spacers. The sequence was selected from many more sequences randomly generated using the <a href="http://www.lifesci.ucsb.edu/~maduro/random.htm">Random DNA Generator </a>engine; the GC% parameter used as input was 50%. The sequences were selected based on the following constraints listed in their order of importance: the absence of any putative promoter regions, a low degree of homology with the Elowitz plasmid (whose components are widely used in our designs), no homology with other <em>E.coli</em> sequences as shown by BLASTN search results and the presence of a number of TAA stop codons. The second constraint was the most stringent leading to the elimination of most sequences. </p> <p> DE made the following changes to the original sequence in order to add stop codons in the -3 frame and more in the +2 frame (note, not all of these stop codons are UAA. Thus, if used in an organism that inserts an amino acid @ UGA or UAG the obvious will occur):<br> T->A @ 85<br> T->A @ 42<br> C->T @ 79<br> A->T @ 64<br> A->T @ 31<br> T->A @ 34<br> C->A @ 37<br> Also, note that the above changes further reduce (the already very weak) homology to current NCBI-stored sequences.<br> </p> <P>In the process of selecting the best sequence it appeared that a good alternative sequence for a spacer would be: AGGTTCTGATATGTAACTGTGCCCAATGTCGTTAGTGACGCATACCTCTTAAGAGGCCACTGTCCTAACA. The sequence contains no putative promoters and shows moderate homology with the 5' end of the Ampicillin resistance gene. However a strong promoter sequence starts 12 bp downstream of this sequence, and therefore the sequence presented above was preferred. </p><P> The sequence is compatible (does not show significant homology) with the components in the Elowitz repressilator plasmid. true Vinay S. Mahajan, Brian Chow, Peter Carr annotation1721 1 Spacer-1 range1721 1 1 70 annotation7030 1 BBa_B0040 range7030 1 1 70 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_I12226 1 BBa_I12226 Generator for wild-type TetR and lambda cI - Gal4 fusion protein 2004-08-08T11:00:00Z 2015-08-31T04:07:32Z This is a generator to create both wild-type TetR and lambda cI - Gal4 fusion protein. It allows one PoPS-in to control two biological ANDs. false false _3_ 0 120 7 Not in stock false false rwald component1042043 1 BBa_I12202 component1042027 1 BBa_B0040 component1042003 1 BBa_B0032 component1042035 1 BBa_B0032 component1042020 1 BBa_I12200 component1042059 1 BBa_B0012 component1042049 1 BBa_B0010 annotation1042035 1 BBa_B0032 range1042035 1 968 980 annotation1042049 1 BBa_B0010 range1042049 1 1647 1726 annotation1042027 1 BBa_B0040 range1042027 1 890 959 annotation1042059 1 BBa_B0012 range1042059 1 1735 1775 annotation1042043 1 BBa_I12202 range1042043 1 987 1613 annotation1042020 1 BBa_I12200 range1042020 1 20 856 annotation1042003 1 BBa_B0032 range1042003 1 1 13 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_I12200 1 fusion Lambda cI - Gal4 fusion protein 2004-08-05T11:00:00Z 2015-08-31T04:07:31Z Lambda phage, Saccharomyces cerevisiae This is the coding region for the Lambda cI - Gal4 fusion protein. This protein is intended to be used as half of a two-hybrid system, with the other half being Alpha-NTD - Gal11p (BBa_I12201). false false _3_ 0 120 7 Not in stock false false rwald annotation1031174 1 Terminator range1031174 1 832 837 annotation1031472 1 cI lambda range1031472 1 1 834 annotation2214019 1 Help:Barcodes range2214019 1 838 862 annotation1031160 1 cI lambda range1031160 1 1 711 annotation1031161 1 gal4 dimerization domain range1031161 1 712 831 BBa_I12202 1 TetR(B) Wild-type TetR(B) (-LVA) 2004-08-05T11:00:00Z 2015-08-31T04:07:31Z Serratia marcescens This is the standard wild-type TetR repressor. It may appear that this is a duplicate of BBa_C0041, but that part has an error near the end which breaks its stop codon. This was presumably to facilitate addition of an LVA tag; nonetheless, for the stand-alone protein, a stop codon is needed. false false _3_ 0 120 7 Not in stock false false rwald annotation1031374 1 tetR range1031374 1 1 627 annotation2214021 1 Help:Barcodes range2214021 1 628 652 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0040_sequence 1 aggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaaca BBa_I12226_sequence 1 tcacacaggaaagtactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgaatcaaggctagaaagactggaacagctatttctactgatttttcctcgagaagaccttgacatgattttgaaaatggattctttacaggatataaaagcattgttaacaggattattttaataaccctgatagtgctagtgtagatccctactagagaggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaacatactagagtcacacaggaaagtactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0032_sequence 1 tcacacaggaaag BBa_I12202_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtcttaataactctgatagtgctagtgtagatctc BBa_I12200_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgaatcaaggctagaaagactggaacagctatttctactgatttttcctcgagaagaccttgacatgattttgaaaatggattctttacaggatataaaagcattgttaacaggattattttaataaccctgatagtgctagtgtagatccc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z