BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I13026 1 BBa_I13026 mnt (weak) QPI intermediate 2004-07-14T11:00:00Z 2015-08-31T04:07:32Z -- No description -- false false _6_ 0 159 7 It's complicated false false jenmitch component939444 1 BBa_C0073 component939428 1 BBa_B0034 annotation939444 1 BBa_C0073 range939444 1 19 306 annotation939428 1 BBa_B0034 range939428 1 1 12 BBa_C0073 1 mnt (w) mnt repressor (weak) from Salmonella phage P22 (+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:23Z enterobacteriophage p22 Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false dimeric repressor from enterobacteriophage p22 with dissociation constant of 3*10^-8.<br/><br/> sequence was translated with the E.Coli K12 codon usage table, and nucleotides 95-97 was changed from AAT to AAC to avoid the cut site GAATTC (94-99).<br/><br/> the mutation R10->K10 (ctg->aaa) decreases the binding affinity of the mnt protein to its operator by approximately 12,000 fold (Kd: 2.5e-12 to 3e-8) true crackdots annotation308213 1 Arg->Lys (ctg) range308213 1 31 33 annotation306535 1 LVA range306535 1 250 282 annotation2214006 1 Help:Barcodes range2214006 1 289 313 annotation308457 1 T range308457 1 95 97 annotation302631 1 mnt range302631 1 1 249 BBa_C0073_sequence 1 atggcccgggatgatcctcacttcaattttaaaatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_B0034_sequence 1 aaagaggagaaa BBa_I13026_sequence 1 aaagaggagaaatactagatggcccgggatgatcctcacttcaattttaaaatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z