BBa_I13030 1 BBa_I13030 mnt (weak) QPI intermediate 2004-07-14T11:00:00Z 2015-08-31T04:07:32Z -- No description -- false false _6_ 0 159 7 It's complicated false false jenmitch component941212 1 BBa_B0010 component941222 1 BBa_B0012 component941239 1 BBa_R0073 annotation941239 1 BBa_R0073 range941239 1 138 204 annotation941222 1 BBa_B0012 range941222 1 89 129 annotation941212 1 BBa_B0010 range941212 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_R0073 1 Mnt Promoter (Mnt regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z enterobacteriophage p22 Released HQ 2013 false false _1_ 0 24 7 In stock false unsure of where -35 site is true crackdots annotation318638 1 dimer right half range318638 1 32 38 annotation302669 1 mnt range302669 1 1 67 annotation318643 1 -10 range318643 1 47 52 annotation318636 1 dimer left half range318636 1 23 29 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0073_sequence 1 ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagtgagtcgtattaattt BBa_I13030_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagtgagtcgtattaattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z