BBa_I13031 1 BBa_I13031 penI QPI intermediate 2004-07-14T11:00:00Z 2015-08-31T04:07:32Z -- No description -- false false _6_ 0 159 7 It's complicated false false jenmitch component941272 1 BBa_R0074 component941252 1 BBa_B0012 component941242 1 BBa_B0010 annotation941242 1 BBa_B0010 range941242 1 1 80 annotation941272 1 BBa_R0074 range941272 1 138 214 annotation941252 1 BBa_B0012 range941252 1 89 129 BBa_R0074 1 PenI Promoter (PenI regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z bacillus licheniformis Released HQ 2013 PenP operator from Bacillus Lichenformis. Two operator sites are negatively regulated by PenI (C0074). false false _1_ 0 24 7 In stock false extends slightly past -50 true crackdots annotation319212 1 -10 range319212 1 46 51 annotation319789 1 dimer right half range319789 1 55 76 annotation302713 1 PenI range302713 1 1 77 annotation319788 1 dimer left half range319788 1 31 53 annotation319211 1 -35 range319211 1 23 28 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0074_sequence 1 tcatttccaaccgaaaaaaggcttgcatttaaatcttacatatgtaatactttcaaagactacatttgtaagatttg BBa_I13031_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtcatttccaaccgaaaaaaggcttgcatttaaatcttacatatgtaatactttcaaagactacatttgtaagatttg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z