BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_R0075 1 cI TP901 Promoter (TP901 cI regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z TP901-1 cI repressor from phage TP901 infecting L. lactis false false _1_ 0 24 7 It's complicated false operator sites: pR and pL false crackdots annotation320591 1 start range320591 1 89 89 annotation302714 1 cI tp901 OR range302714 1 19 57 annotation319985 1 -10 range319985 1 76 82 annotation319984 1 cI tp901 OL range319984 1 85 115 annotation319983 1 -35 range319983 1 53 59 BBa_I13032 1 BBa_I13032 cI (TP-901) QPI intermediate 2004-07-14T11:00:00Z 2015-08-31T04:07:32Z -- No description -- false false _6_ 0 159 7 It's complicated false false jenmitch component941275 1 BBa_B0010 component941305 1 BBa_R0075 component941285 1 BBa_B0012 annotation941275 1 BBa_B0010 range941275 1 1 80 annotation941285 1 BBa_B0012 range941285 1 89 129 annotation941305 1 BBa_R0075 range941305 1 138 254 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0075_sequence 1 cgcatcttgaacaaaagttcaacaaaaaaattcatatttcgtgaacttttttgttgacaaagataaaaacacatgatatactaatttcataaagttcatgaaacgtgaactgaaatt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I13032_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagcgcatcttgaacaaaagttcaacaaaaaaattcatatttcgtgaacttttttgttgacaaagataaaaacacatgatatactaatttcataaagttcatgaaacgtgaactgaaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z