BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_C0160 1 aiiA autoinducer inactivation enzyme aiiA (no LVA) 2004-05-26T11:00:00Z 2015-08-31T04:07:24Z Released HQ 2013 same as C0060 except no LVA tag false false _11_1_ 0 61 7 In stock false true jcbraff annotation1891585 1 aiiA range1891585 1 1 756 BBa_I13206 1 BBa_I13206 aiiA (LVA-) protein generator driven by ptet 2004-07-29T11:00:00Z 2015-08-31T04:07:33Z Produces aiiA protein from the tet promoter. The aiiA is untagged and should be capable of degrading any intracellular AHL. false false _11_6_ 0 135 7 Not in stock false false Barry Canton component1251284 1 BBa_R0040 component1251299 1 BBa_B0010 component1251294 1 BBa_C0160 component1251292 1 BBa_B0034 component1251309 1 BBa_B0012 annotation1251284 1 BBa_R0040 range1251284 1 1 54 annotation1251299 1 BBa_B0010 range1251299 1 845 924 annotation1251309 1 BBa_B0012 range1251309 1 933 973 annotation1251294 1 BBa_C0160 range1251294 1 81 836 annotation1251292 1 BBa_B0034 range1251292 1 63 74 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_C0160_sequence 1 atgacagtaaagaagctttatttcgtcccagcaggtcgttgtatgttggatcattcgtctgttaatagtacattaacaccaggagaattattagacttaccggtttggtgttatcttttggagactgaagaaggacctattttagtagatacaggtatgccagaaagtgcagttaataatgaaggtctttttaacggtacatttgtcgaagggcaggttttaccgaaaatgactgaagaagatagaatcgtgaatattttaaaacgggttggttatgagccggaagaccttctttatattattagttctcacttgcattttgatcatgcaggaggaaatggcgcttttataaatacaccaatcattgtacagcgtgctgaatatgaggcggcgcagcatagcgaagaatatttgaaagaatgtatattgccgaatttaaactacaaaatcattgaaggtgattatgaagtcgtaccaggagttcaattattgcatacaccaggccatactccagggcatcaatcgctattaattgagacagaaaaatccggtcctgtattattaacgattgatgcatcgtatacgaaagagaattttgaaaatgaagtgccatttgcgggatttgattcagaattagctttatcttcaattaaacgtttaaaagaagtggtgatgaaagagaagccgattgttttctttggacatgatatagagcaggaaaggggatgtaaagtgttccctgaatatatataataa BBa_I13206_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgacagtaaagaagctttatttcgtcccagcaggtcgttgtatgttggatcattcgtctgttaatagtacattaacaccaggagaattattagacttaccggtttggtgttatcttttggagactgaagaaggacctattttagtagatacaggtatgccagaaagtgcagttaataatgaaggtctttttaacggtacatttgtcgaagggcaggttttaccgaaaatgactgaagaagatagaatcgtgaatattttaaaacgggttggttatgagccggaagaccttctttatattattagttctcacttgcattttgatcatgcaggaggaaatggcgcttttataaatacaccaatcattgtacagcgtgctgaatatgaggcggcgcagcatagcgaagaatatttgaaagaatgtatattgccgaatttaaactacaaaatcattgaaggtgattatgaagtcgtaccaggagttcaattattgcatacaccaggccatactccagggcatcaatcgctattaattgagacagaaaaatccggtcctgtattattaacgattgatgcatcgtatacgaaagagaattttgaaaatgaagtgccatttgcgggatttgattcagaattagctttatcttcaattaaacgtttaaaagaagtggtgatgaaagagaagccgattgttttctttggacatgatatagagcaggaaaggggatgtaaagtgttccctgaatatatataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z