BBa_I13220 1 BBa_I13220 Natural Lux Promoter 2nd Generation 2004-08-17T11:00:00Z 2015-08-31T04:07:33Z pTK-1 A slightly different sequence than the original; the coverage has been shifted. It should function the same way the original was intended, left repression by hsl-bound LuxR and right activation by hsl-bound LuxR. false false _6_ 0 101 7 Not in stock false false mit BBa_I13220_sequence 1 ttacctattgtttgtcgcaagttttgcgtgttatatatcattaaaacggtaatggattgacatttgattctaataaattggatttttgtcacactattgtatcgctgggaatacaattacttaacataagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z