BBa_R0078 1 cinR Promoter (cinR and HSL regulated) 2004-01-29T12:00:00Z 2015-05-08T01:14:15Z Rhizobium leguminosarum Released HQ 2013 false false _1_ 0 24 7 In stock false true Drew Endy annotation318234 1 unidentified/uncharacterized CinR dependent range318234 1 1 220 annotation318250 1 stem_loop range318250 1 91 136 annotation318244 1 stem_loop range318244 1 35 74 BBa_I13277 1 BBa_I13277 PoPS->PoPS amplifier (CinR-based, HSL driven) 2004-08-08T11:00:00Z 2015-08-31T04:07:33Z CinR protein generator upstream of pCin. Useful device for cell-cell signaling. Expected to require HSL for maximum PoPS out. false false _6_ 0 101 7 Not in stock false false Debra Lin, Cell-Cell Signaling SMUG component1038908 1 BBa_B0034 component1038918 1 BBa_C0077 component1038948 1 BBa_R0078 component1038924 1 BBa_B0010 component1038934 1 BBa_B0012 annotation1038934 1 BBa_B0012 range1038934 1 902 942 annotation1038948 1 BBa_R0078 range1038948 1 951 1175 annotation1038918 1 BBa_C0077 range1038918 1 19 780 annotation1038908 1 BBa_B0034 range1038908 1 1 12 annotation1038924 1 BBa_B0010 range1038924 1 814 893 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_C0077 1 cinr cinR activator from Rhizobium leguminosarum (+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:24Z Rhizobium leguminosarum Released HQ 2013 In complex with O3-C14:1-HSL (made by BBa_C0076), CinR binds to the Cin promoter (BBa_R0077) and activates transcription. false false _1_ 0 24 7 In stock false The regulatory locus cinRI in Rhizobium leguminosarum conrols a network of quorum-sensing loci Lithgow, JK; Wilkinson, A; Hardman, A; Rodelas, B; Wisniewski-Dye, F; Williams, P; Downie, AJ MOL. MICROBIOLOGY 37(1): 81-97, 2000 <P>Change log: original STOP: tag -> taATAA true crackdots annotation2214000 1 Help:Barcodes range2214000 1 763 787 annotation306600 1 LVA range306600 1 724 756 annotation301112 1 cinR range301112 1 1 723 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0078_sequence 1 ccctttgtgcgtccaaacggacgcacggcgctctaaagcgggtcgcgatctttcagattcgctcctcgcgctttcagtctttgttttggcgcatgtcgttatcgcaaaaccgctgcacacttttgcgcgacatgctctgatccccctcatctgggggggcctatctgagggaatttccgatccggctcgcctgaaccattctgctttccacgaacttgaaaacgc BBa_B0034_sequence 1 aaagaggagaaa BBa_C0077_sequence 1 atgattgagaatacctatagcgaaaagttcgagtccgcgttcgaacagatcaaggcggcggccaacgtggatgccgccatccgtattctccaggcggaatataacctcgatttcgtcacctaccatctcgcccagacgatcgcgagcaagatcgattcgcccttcgtgcgcaccacctatccggatgcctgggtttcccgctacctcctcaacagctatgtgaaggtcgatccgatcgtcaagcagggcttcgaacgccagctgcccttcgactggagcgaggtcgaaccgacgccggaggcctatgccatgctggtcgacgcccagaaacacggcatcggtggcaatggctactccatccccgtcgccgacaaggcgcagcgccgcgccctgctgtcgctgaatgcccgtataccggccgacgaatggaccgagctcgtgcgccgctgccgcaacgagtggatcgagatcgcccatctgatccaccgcaaggccgtctatgagctgcatggcgaaaacgatccggtgccggcattgtcgccgcgcgagatcgagtgtctgcactggaccgccctcggcaaggattacaaggatatttcggtcatcctgggcatatcagagcataccacacgcgattacctgaagaccgcccgcttcaagctcggctgcgccacgatctcggccgccgcgtcgcgggctgttcaattgcgcatcatcaatcccgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I13277_sequence 1 aaagaggagaaatactagatgattgagaatacctatagcgaaaagttcgagtccgcgttcgaacagatcaaggcggcggccaacgtggatgccgccatccgtattctccaggcggaatataacctcgatttcgtcacctaccatctcgcccagacgatcgcgagcaagatcgattcgcccttcgtgcgcaccacctatccggatgcctgggtttcccgctacctcctcaacagctatgtgaaggtcgatccgatcgtcaagcagggcttcgaacgccagctgcccttcgactggagcgaggtcgaaccgacgccggaggcctatgccatgctggtcgacgcccagaaacacggcatcggtggcaatggctactccatccccgtcgccgacaaggcgcagcgccgcgccctgctgtcgctgaatgcccgtataccggccgacgaatggaccgagctcgtgcgccgctgccgcaacgagtggatcgagatcgcccatctgatccaccgcaaggccgtctatgagctgcatggcgaaaacgatccggtgccggcattgtcgccgcgcgagatcgagtgtctgcactggaccgccctcggcaaggattacaaggatatttcggtcatcctgggcatatcagagcataccacacgcgattacctgaagaccgcccgcttcaagctcggctgcgccacgatctcggccgccgcgtcgcgggctgttcaattgcgcatcatcaatcccgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagccctttgtgcgtccaaacggacgcacggcgctctaaagcgggtcgcgatctttcagattcgctcctcgcgctttcagtctttgttttggcgcatgtcgttatcgcaaaaccgctgcacacttttgcgcgacatgctctgatccccctcatctgggggggcctatctgagggaatttccgatccggctcgcctgaaccattctgctttccacgaacttgaaaacgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z