BBa_I13450 1 BBa_I13450 Removes BioBrick End 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 Contains both an early MfeI site and a late NsiI site. Cutting with Mfe and Spe and ligation to a BB part cut EX will form two mixed sites, neither of which can be recut. Cutting with Xba and Nsi and ligation to a BB part cut SP will again form two mixed sites, neither of which can be recut. false false _11_ 0 253 6 In stock false Should be grown in pSB1A2, as Nsi cuts both pSB2K3 and pSB1AK3 and Mfe cuts pSB4A3. 70 bp from Xba to Nsi or Mfe to Spe, the minimum for gel extraction. The middle is largely noise, to raise the size of the part. false jkm annotation1494630 1 NsiI range1494630 1 68 73 annotation1494720 1 MfeI range1494720 1 2 7 BBa_I13450_sequence 1 tcaattgaggtagaggtacacacgcgaactccgatagccaattcagagtaataaactgtgataatcaatgcatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z