BBa_I13452 1 BBa_I13452 Adds another BioBrick site 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 Contains both a BbsI and a BstXI restriction site. When cut with both enzymes, it leaves an EcoRI and a PstI site. false false _11_ 0 253 6 In stock false 70 bp from Eco to Spe or Xba to Pst, to allow for gel extraction. The middle portion is largely noise, intended as filler to raise the size of the part. true jkm annotation1891621 1 BstXI site range1891621 1 41 52 annotation1891619 1 Future Eco site range1891619 1 1 6 annotation1891620 1 BbsI site range1891620 1 8 13 annotation1891622 1 Future Pst site range1891622 1 44 49 BBa_I13452_sequence 1 gaattaggtcttcgaatcacaaagattagtcacacgcgatccattgcagtgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z