BBa_I13452 1 BBa_I13452 Adds another BioBrick site 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 Contains both a BbsI and a BstXI restriction site. When cut with both enzymes, it leaves an EcoRI and a PstI site. false false _11_ 0 253 6 In stock false 70 bp from Eco to Spe or Xba to Pst, to allow for gel extraction. The middle portion is largely noise, intended as filler to raise the size of the part. true jkm annotation1891620 1 BbsI site range1891620 1 8 13 annotation1891619 1 Future Eco site range1891619 1 1 6 annotation1891622 1 Future Pst site range1891622 1 44 49 annotation1891621 1 BstXI site range1891621 1 41 52 BBa_I13505 1 BBa_I13505 Screening plasmid intermediate 2005-05-30T11:00:00Z 2015-08-31T04:07:34Z Built by Josh as an intermediate in screening plasmid construction true false _11_ 0 253 6 Discontinued false false jkm component1505103 1 BBa_B0034 component1505098 1 BBa_I13452 annotation1505098 1 BBa_I13452 range1505098 1 1 52 annotation1505103 1 BBa_B0034 range1505103 1 61 72 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_I13505_sequence 1 gaattaggtcttcgaatcacaaagattagtcacacgcgatccattgcagtggtactagagaaagaggagaaa BBa_I13452_sequence 1 gaattaggtcttcgaatcacaaagattagtcacacgcgatccattgcagtgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z