BBa_I13579 1 BBa_I13579 1/2 Insert/hairpin (I13457) 2007-06-13T11:00:00Z 2015-08-31T04:07:35Z . Component for Empty Screening Plasmid test constructs. It's the downstream portion of I13457 split where a part would be inserted into the screening plasmid. false false _11_84_ 0 2 84 Not in stock false . false Jason Kelly BBa_I13579_sequence 1 cgatccattgcagtggtattatttgtattgatctccttactatctctcgagagattagtacctttggagatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z