BBa_I13710 1 BBa_I13710 CheY behind a tet promoter 2004-08-12T11:00:00Z 2015-08-31T04:07:36Z Tet promoter, Elowitz RBS, CheY coding. CheY is used in chemotaxis. false false _6_ 0 101 7 Not in stock false false Victoria Chou, Kenneth Nesmith, Madeleine Sheldon-Dante component2221608 1 BBa_B0034 component2221610 1 BBa_C0020 component2221602 1 BBa_R0040 component2221617 1 BBa_B0015 annotation2221610 1 BBa_C0020 range2221610 1 81 473 annotation2221617 1 BBa_B0015 range2221617 1 482 610 annotation2221608 1 BBa_B0034 range2221608 1 63 74 annotation2221602 1 BBa_R0040 range2221602 1 1 54 BBa_C0020 1 cheY CheY "tumbling" chemotaxis coding sequence 2004-08-01T11:00:00Z 2015-08-31T04:07:23Z NCBI - Escherichia coli K12 MG1655 (NC_000913) This part codes for CheY, a protein used by E. coli for chemotaxis. Increased concentrations of CheY has been shown to make E. coli tumble more. false true _6_ 0 101 7 It's complicated false Changes from the NCBI sequence: A BioBricks restriction site for PstI was at position 260. As a result, the codon starting at position 262 was changed from "gca" to "gcg". <p> The terminating codon at the end, "tga", was changed to "taataa" as per BioBrick regulations as told to us by Randy Rettberg. false Victoria Chou, Kenneth Nesmith, Madeleine Sheldon-Dante annotation1891581 1 cheY range1891581 1 1 393 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I13710_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatggcggataaagaacttaaatttttggttgtggatgacttttccaccatgcgacgcatagtgcgtaacctgctgaaagagctgggattcaataatgttgaggaagcggaagatggcgtcgacgctctcaataagttgcaggcaggcggttatggatttgttatctccgactggaacatgcccaatatggatggcctggaattgctgaaaacaattcgtgcggatggcgcgatgtcggcattgccagtgttaatggtgactgcggaagcgaagaaagagaacatcattgctgcggcgcaagcgggggccagtggctatgtggtgaagccatttaccgccgcgacgctggaggaaaaactcaacaaaatctttgagaaactgggcatgtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_C0020_sequence 1 atggcggataaagaacttaaatttttggttgtggatgacttttccaccatgcgacgcatagtgcgtaacctgctgaaagagctgggattcaataatgttgaggaagcggaagatggcgtcgacgctctcaataagttgcaggcaggcggttatggatttgttatctccgactggaacatgcccaatatggatggcctggaattgctgaaaacaattcgtgcggatggcgcgatgtcggcattgccagtgttaatggtgactgcggaagcgaagaaagagaacatcattgctgcggcgcaagcgggggccagtggctatgtggtgaagccatttaccgccgcgacgctggaggaaaaactcaacaaaatctttgagaaactgggcatgtaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z