BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I13712 1 BBa_I13712 CheR behind a tet promoter and Elowitz RBS 2004-08-12T11:00:00Z 2015-08-31T04:07:36Z -- No description -- false false _6_ 0 101 7 Not in stock false false Victoria Chou, Kenneth Nesmith, Madeleine Sheldon-Dante component1045364 1 BBa_B0034 component1045374 1 BBa_B0010 component1045368 1 BBa_C0028 component1045384 1 BBa_B0012 component1045356 1 BBa_R0040 annotation1045364 1 BBa_B0034 range1045364 1 63 74 annotation1045368 1 BBa_C0028 range1045368 1 81 944 annotation1045356 1 BBa_R0040 range1045356 1 1 54 annotation1045384 1 BBa_B0012 range1045384 1 1066 1106 annotation1045374 1 BBa_B0010 range1045374 1 978 1057 BBa_C0028 1 cher CheR chemotaxis coding region 2004-08-01T11:00:00Z 2015-08-31T04:07:23Z NCBI - E. Coli K12 substrain: MG1655 CheR is part of the chemotaxis pathway in E. Coli. (Was part # I13702) false false _6_ 0 101 7 Not in stock false Checked (DE, VC, KN). Part ready for synthesis (8/3/4) <P>sequence data at http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene&cmd=Retrieve&dopt=Graphics&list_uids=946396 false MIT SBC 2004 (Ken) annotation2214018 1 Help:Barcodes range2214018 1 865 889 annotation1891584 1 CheB range1891584 1 1 864 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0028_sequence 1 atgacttcatctctgccctgtgggcaaacgtctttattgttacagatgaccgagcgcctggcgctttccgacgcgcattttcggcggataagtcaattgatctatcaacgagccgggatcgttctggctgaccataaacgcgacatggtttacaaccgactggttcgtcgtttgcgttcgctgggactgacggatttcggtcattatctgaacttgctggaatctaatcagcacagcggtgagtggcaggcgtttatcaattcgctgaccacgaatctgacggcatttttccgtgaggcacatcatttccctctgctcgcggatcacgcacgtcgccgttctggcgagtatcgcgtatggagcgcggcggcttcgaccggcgaagagccgtacagcattgcgatgacgctggctgacacattgggcaccgcgcccggacgctggaaagtgtttgccagtgatatcgacaccgaagtgctggaaaaagccagaagcggtatctatcgccatgaagagttgaaaaacctgacgccgcagcaactgcaacggtatttcatgcgagggacggggccgcatgaagggctggtacgcgtgcgtcaggagctggcgaactatgttgattttgccccgctgaatctactggcgaaacagtacaccgtgccggggccgtttgatgcgatcttctgtcgtaacgtcatgatctacttcgatcaaactacccagcaggagattttgcgccgctttgttccgctccttaaacccgacggattgctgtttgcgggtcactctgaaaactttagccaccttgagcgccgcttcacgctgcgtggtcagacggtgtatgcgctaagtaaggattaataacgctgatagtgctagtgtagatcgc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_I13712_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgacttcatctctgccctgtgggcaaacgtctttattgttacagatgaccgagcgcctggcgctttccgacgcgcattttcggcggataagtcaattgatctatcaacgagccgggatcgttctggctgaccataaacgcgacatggtttacaaccgactggttcgtcgtttgcgttcgctgggactgacggatttcggtcattatctgaacttgctggaatctaatcagcacagcggtgagtggcaggcgtttatcaattcgctgaccacgaatctgacggcatttttccgtgaggcacatcatttccctctgctcgcggatcacgcacgtcgccgttctggcgagtatcgcgtatggagcgcggcggcttcgaccggcgaagagccgtacagcattgcgatgacgctggctgacacattgggcaccgcgcccggacgctggaaagtgtttgccagtgatatcgacaccgaagtgctggaaaaagccagaagcggtatctatcgccatgaagagttgaaaaacctgacgccgcagcaactgcaacggtatttcatgcgagggacggggccgcatgaagggctggtacgcgtgcgtcaggagctggcgaactatgttgattttgccccgctgaatctactggcgaaacagtacaccgtgccggggccgtttgatgcgatcttctgtcgtaacgtcatgatctacttcgatcaaactacccagcaggagattttgcgccgctttgttccgctccttaaacccgacggattgctgtttgcgggtcactctgaaaactttagccaccttgagcgccgcttcacgctgcgtggtcagacggtgtatgcgctaagtaaggattaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z