BBa_I14018 1 Bla P(Bla) 2004-08-01T11:00:00Z 2015-08-31T04:07:37Z Plasmid pUC19 Released HQ 2013 P(Bla), Medium Transcription false false _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1027016 1 -10 range1027016 1 25 30 annotation1027020 1 -35 range1027020 1 4 9 annotation1018027 1 P(Bla) range1018027 1 1 35 BBa_I14018_sequence 1 tgtaagtttatacataggcgagtactctgttatgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z