BBa_I14021 1 BBa_I14021 plTetO1 . RBS . CinI 2004-08-01T11:00:00Z 2015-08-31T04:07:37Z BBa_R0040 BBa_I14020 false false _4_ 0 166 7 Not in stock false false Aditi Shrivastava, Jiwon Lee, Sarah Welch component1018379 1 BBa_C0076 component1018368 1 BBa_B0030 component1018357 1 BBa_R0040 annotation1018368 1 BBa_B0030 range1018368 1 63 77 annotation1018357 1 BBa_R0040 range1018357 1 1 54 annotation1018379 1 BBa_C0076 range1018379 1 84 785 BBa_C0076 1 cinI autoinducer synthetase 2004-01-27T12:00:00Z 2015-08-31T04:07:24Z Rhizobium leguminosarum Released HQ 2013 cinI codes for an autoinducer synthetase which utilizes SAM to make O3-C14:1-HSL. In complex with O3-C14:1-HSL, CinR (BBa_C0077) binds to the Cin promoter (BBa_R0077) and activates transcription. false false _1_ 0 24 7 In stock false The regulatory locus cinRI in Rhizobium leguminosarum conrols a network of quorum-sensing loci Lithgow, JK; Wilkinson, A; Hardman, A; Rodelas, B; Wisniewski-Dye, F; Williams, P; Downie, AJ MOL. MICROBIOLOGY 37(1): 81-97, 2000 <P>Change log: original STOP: tga -> tAaTAA true crackdots annotation2214001 1 Help:Barcodes range2214001 1 703 727 annotation306586 1 LVA range306586 1 664 696 annotation301035 1 CinI range301035 1 1 663 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0030_sequence 1 attaaagaggagaaa BBa_C0076_sequence 1 atgttcgttatcatccaggctcacgaataccagaaatacgctgctgttctggaccagatgttccgtctgcgtaaaaaagttttcgctgacaccctgtgctgggacgttccggttatcggtccgtacgaacgtgactcctacgactccctggctccggcttacctggtttggtgcaacgactcccgtacccgtctgtacggtggtatgcgtctgatgccgaccaccggtccgaccctgctgtacgacgttttccgtgaaaccttcccggacgctgctgacctgatcgctccgggtatctgggaaggtacccgtatgtgcatcgacgaagaagctatcgctaaagacttcccggaaatcgacgctggtcgtgctttctccatgatgctgctggctctgtgcgaatgcgctctggaccacggtatccacaccatgatctccaactacgaaccgtacctgaaacgtgtttacaaacgtgctggtgctgaagttgaagaactgggtcgtgctgacggttacggtaaatacccggtttgctgcggtgctttcgaagtttccgaccgtgttctgcgtaaaatgcgtgctgctctgggtctgaccctgccgctgtacgttcgtcacgttccggctcgttccgttgttacccagttcctggaaatggctgctgctgctaacgacgaaaactacgctctggttgcttaataaccctgatagtgctagtgtagatccc BBa_I14021_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagattaaagaggagaaatactagatgttcgttatcatccaggctcacgaataccagaaatacgctgctgttctggaccagatgttccgtctgcgtaaaaaagttttcgctgacaccctgtgctgggacgttccggttatcggtccgtacgaacgtgactcctacgactccctggctccggcttacctggtttggtgcaacgactcccgtacccgtctgtacggtggtatgcgtctgatgccgaccaccggtccgaccctgctgtacgacgttttccgtgaaaccttcccggacgctgctgacctgatcgctccgggtatctgggaaggtacccgtatgtgcatcgacgaagaagctatcgctaaagacttcccggaaatcgacgctggtcgtgctttctccatgatgctgctggctctgtgcgaatgcgctctggaccacggtatccacaccatgatctccaactacgaaccgtacctgaaacgtgtttacaaacgtgctggtgctgaagttgaagaactgggtcgtgctgacggttacggtaaatacccggtttgctgcggtgctttcgaagtttccgaccgtgttctgcgtaaaatgcgtgctgctctgggtctgaccctgccgctgtacgttcgtcacgttccggctcgttccgttgttacccagttcctggaaatggctgctgctgctaacgacgaaaactacgctctggttgcttaataaccctgatagtgctagtgtagatccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z