BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_Q04740 1 BBa_Q04740 Pen1 quad part inverter 2004-07-04T11:00:00Z 2015-05-08T01:14:14Z Crackdots -- No description -- false false _11_6_ 0 135 7 Not in stock false false Barry Canton component953148 1 BBa_R0074 component953128 1 BBa_B0012 component953118 1 BBa_B0010 component953112 1 BBa_C0074 component953102 1 BBa_B0034 annotation953148 1 BBa_R0074 range953148 1 612 688 annotation953112 1 BBa_C0074 range953112 1 19 441 annotation953102 1 BBa_B0034 range953102 1 1 12 annotation953128 1 BBa_B0012 range953128 1 563 603 annotation953118 1 BBa_B0010 range953118 1 475 554 BBa_B0064 1 BBa_B0064 Tuned RBS for Q04401 2008-02-23T12:00:00Z 2015-08-31T04:07:21Z . This is a single bp change from B0034. It's strength is approximately 35% that of B0034. false false _11_ 0 2 84 Not in stock false . false Jason Kelly BBa_Q04401 1 tetR inver TetR-derived transcriptional inverter 2006-05-10T11:00:00Z 2015-05-08T01:14:13Z Currently entered as a placeholder. This is a modified version of the tetR inverter Q04400 with a single base switch in the RBS: AAAGAGGAGAAA to AAAGAGGGGAAA false false _11_ 0 253 6 Not in stock false false Josh Michener component2251471 1 BBa_R0040 component2251463 1 BBa_C0040 component2251470 1 BBa_B0015 component2251459 1 BBa_B0064 annotation2251471 1 BBa_R0040 range2251471 1 849 902 annotation2251470 1 BBa_B0015 range2251470 1 712 840 annotation2251463 1 BBa_C0040 range2251463 1 19 703 annotation2251459 1 BBa_B0064 range2251459 1 1 12 BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation23329 1 tetR range23329 1 4 620 annotation2213989 1 Help:Barcodes range2213989 1 661 685 annotation23330 1 SsrA range23330 1 621 654 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_R0074 1 PenI Promoter (PenI regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z bacillus licheniformis Released HQ 2013 PenP operator from Bacillus Lichenformis. Two operator sites are negatively regulated by PenI (C0074). false false _1_ 0 24 7 In stock false extends slightly past -50 true crackdots annotation319211 1 -35 range319211 1 23 28 annotation319789 1 dimer right half range319789 1 55 76 annotation319212 1 -10 range319212 1 46 51 annotation302713 1 PenI range302713 1 1 77 annotation319788 1 dimer left half range319788 1 31 53 BBa_C0074 1 penI penI repressor from Bacillus licheniformis (+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:23Z bacillus licheniformis Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false Since penI is being ported from Bacillus Licheniformis, the sequence was changed within the coding region to reflect codon usage in E.Coli K12. Codons were mapped to the codon of the same usage rank in E.Coli. true crackdots annotation306563 1 LVA range306563 1 385 417 annotation2214009 1 Help:Barcodes range2214009 1 424 448 annotation302638 1 penI range302638 1 1 387 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I14103 1 BBa_I14103 penI inverter + tetR inverter 2006-01-17T12:00:00Z 2015-08-31T04:07:38Z bistable switch false false _11_ 0 546 11 Not in stock false false Kelly Chang component2259950 1 BBa_Q04401 component2259932 1 BBa_Q04740 annotation2259932 1 BBa_Q04740 range2259932 1 1 688 annotation2259950 1 BBa_Q04401 range2259950 1 697 1598 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0074_sequence 1 tcatttccaaccgaaaaaaggcttgcatttaaatcttacatatgtaatactttcaaagactacatttgtaagatttg BBa_B0034_sequence 1 aaagaggagaaa BBa_B0064_sequence 1 aaagaggggaaa BBa_C0074_sequence 1 atgaaaaaaataccacagatttctgatgcggaactcgaagtcatgaaagtgatttggaagcattcttccattaatactaatgaggtaatcaaagagctcagtaaaacttcaacgtggagcccaaaaactattcagactatgctgctgcgccttatcaaaaaaggcgctctcaaccaccataaagaaggtcgggttttcgtttacacgcctaatatagacgaatcagattatatagaggttaagtcacactcatttctcaaccggttttacaatggtacattaaattccatggtactcaactttttggagaatgatcaactgtcgggagaagaaatcaatgaattgtatcagatactcgaagaacataagaaccgtaagaaggaagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_I14103_sequence 1 aaagaggagaaatactagatgaaaaaaataccacagatttctgatgcggaactcgaagtcatgaaagtgatttggaagcattcttccattaatactaatgaggtaatcaaagagctcagtaaaacttcaacgtggagcccaaaaactattcagactatgctgctgcgccttatcaaaaaaggcgctctcaaccaccataaagaaggtcgggttttcgtttacacgcctaatatagacgaatcagattatatagaggttaagtcacactcatttctcaaccggttttacaatggtacattaaattccatggtactcaactttttggagaatgatcaactgtcgggagaagaaatcaatgaattgtatcagatactcgaagaacataagaaccgtaagaaggaagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtcatttccaaccgaaaaaaggcttgcatttaaatcttacatatgtaatactttcaaagactacatttgtaagatttgtactagagaaagaggggaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_Q04401_sequence 1 aaagaggggaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_Q04740_sequence 1 aaagaggagaaatactagatgaaaaaaataccacagatttctgatgcggaactcgaagtcatgaaagtgatttggaagcattcttccattaatactaatgaggtaatcaaagagctcagtaaaacttcaacgtggagcccaaaaactattcagactatgctgctgcgccttatcaaaaaaggcgctctcaaccaccataaagaaggtcgggttttcgtttacacgcctaatatagacgaatcagattatatagaggttaagtcacactcatttctcaaccggttttacaatggtacattaaattccatggtactcaactttttggagaatgatcaactgtcgggagaagaaatcaatgaattgtatcagatactcgaagaacataagaaccgtaagaaggaagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtcatttccaaccgaaaaaaggcttgcatttaaatcttacatatgtaatactttcaaagactacatttgtaagatttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z