BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_I20255 1 BBa_I20255 Promoter-RBS 2007-12-07T12:00:00Z 2015-08-31T04:07:39Z . This is part of a collection of promoter RBS pairs that are being built to evaluate the Measurement Kit being made in the Endy lab. false false _11_ 0 2 84 Not in stock false . false Jason Kelly component1958883 1 BBa_J23116 component1958885 1 BBa_B0031 annotation1958883 1 BBa_J23116 range1958883 1 1 35 annotation1958885 1 BBa_B0031 range1958885 1 44 57 BBa_J23116 1 BBa_J23116 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23116_sequence 1 ttgacagctagctcagtcctagggactatgctagc BBa_B0031_sequence 1 tcacacaggaaacc BBa_I20255_sequence 1 ttgacagctagctcagtcctagggactatgctagctactagagtcacacaggaaacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z