BBa_I20289 1 BBa_I20289 PhiRVI excisionase-Freiburg Standard 2009-07-10T11:00:00Z 2015-08-31T04:07:40Z http://www.uniprot.org/uniprot/O06606 This protein is a recombination directionality factor (RDF). Association with TP901-1 integrase, and triggers recombination between AttL and attR and excision of the phage genome. Reverse inversion reaction when attL and attR in same DNA molecule. No known catalytic activity per se. false false _11_ 0 3868 11 Not in stock false none false Jerome Bonnet annotation2011215 1 NgoMIV range2011215 1 4 9 annotation2011216 1 AgeI range2011216 1 226 231 annotation2011214 1 Start range2011214 1 1 3 BBa_I20289_sequence 1 atggccggctcgaccatctaccatcatcgcggtcgcgtagccgcactgtctcgttcccgcgcatccgacgatcccgagttcatcgccgcgaaaaccgatctcgttgccgcgaacatcgcggactacctcatccgcaccctcgccgcagcgccgcccctgactgacgagcagcgcacccggctggccgagctgctgcgccccgtgcggcggtcaggcggtgcccgaaccggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z