BBa_I20290 1 BBa_I20290 Bxb1 attB-Forward 2009-07-10T11:00:00Z 2015-08-31T04:07:40Z upcoming Bxb1 integrase catalyse recombination of Bxb1-attB with Bxb1-AttP. If the 2 sites are in the same molecule, recombination outcome can be:a) excision of the sequence in between ( att sites in parallel orientation) b) sequence inversion (att sites in antiparallel orientation). false false _11_ 0 3868 11 Not in stock false upcoming false Jerome Bonnet annotation2011217 1 core range2011217 1 22 29 annotation2011218 1 GT central dinucleotide range2011218 1 25 26 BBa_I20290_sequence 1 tcggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z