BBa_I20292 1 BBa_I20292 There is no limit to what a man can do or where he can go if... 2009-10-04T11:00:00Z 2015-08-31T04:07:40Z De novo via reverse translation from the single letter amino acid sequence. Sequence of DNA encoding the quote from Ronald Reagan's First Inaugural address, "There is no limit to what a man can do or where he can go if he doesn't mind who gets the credit." Q was substituted for O. false false _11_ 0 52 167 Not in stock false O->Q substitutions, throughout. false Drew Endy BBa_I20292_sequence 1 acccatgaacgcgaaattagcaaccagctgattatgattaccacccagtggcatgcgaccgcgatggcgaactgcgcgaacgatcagcagcgctggcatgaacgcgaacatgaatgcgcgaacggccagatttttcatgaagatcaggaaagcaacaccatgattaacgattggcatcagggcgaaaccagcacccatgaatgccgcgaagatattacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z