BBa_R0184 1 BBa_R0184 T7 promoter (lacI repressible) 2007-04-25T11:00:00Z 2015-05-08T01:14:15Z This sequence is based on the T7lac promoter described by Dubendorff and Studier (JMB 1991, 219, 45-59). The only modification is the mutation at -16. A mutant version of the T7lac promoter designed by Dubendorff and Studier. The promoter is based on the strong ??10 T7 promoter but incorporates an A->C mutation at -16. The LacI operator site is a partially symmetric 25bp sequence. false false _11_ 0 135 84 Not in stock false The -16 mutation was included to weaken the consensus promoter as described by Imburgio and co-workers (see BBa_R0183 for more information) false Bartholomew Canton annotation1932680 1 Center of binding site symmetry range1932680 1 31 31 annotation1932679 1 lacI binding site range1932679 1 20 44 annotation1932678 1 BBa_R0183 fragment range1932678 1 1 20 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_I2033 1 BBa_I2033 lacI repressible T7 promoter and a weak E. coli RBS 2007-05-12T11:00:00Z 2015-08-31T04:07:40Z composite part This part is an intermediate test construct in an early version of a biological virtual machine (VM2.0). It is composed of a lacI repressible T7 promoter and an E. coli RBS. The composite part can be composed with a coding region which will be expressed in the presence of T7 RNA polymerase and in the absence of sufficient amounts of lacI repressor. false false _11_ 0 135 84 Not in stock false n/a false Bartholomew Canton component2218383 1 BBa_R0184 component2218385 1 BBa_B0032 annotation2218383 1 BBa_R0184 range2218383 1 1 44 annotation2218385 1 BBa_B0032 range2218385 1 53 65 BBa_R0184_sequence 1 tcatacgactcactataggggaattgtgagcggataacaattcc BBa_B0032_sequence 1 tcacacaggaaag BBa_I2033_sequence 1 tcatacgactcactataggggaattgtgagcggataacaattcctactagagtcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z