BBa_I20530 1 BBa_I20530 Consensus promoter for phage K1-5 RNA polymerase 2011-06-16T11:00:00Z 2015-08-31T04:07:40Z From the phage K1-5 genome sequence. Genbank accession number AY370674. Also, please see doi:10.1016/j.jmb.2003.11.035 From Scholl et al. Journal of Molecular Biology, Volume 335, Issue 5, 30 January 2004, Pages 1151-1171 "Most SP6 and K1-5 transcription occurs using their respective phage-encoded RNAPs. Several SP6 promoters have been identified and cloned and transcriptional activity with respect to promoter sequence has been examined comprehensively by saturation mutagenesis.[33.] and [34.] On the basis of this information we have identified 12 phage RNAP promoters in the SP6 genome. Only the promoter upstream of ORF31 conforms exactly to the consensus. Three promoter-like sequences that contain one or more nucleotide changes at conserved positions, including+1G that is required for SP6 RNAP transcription initiation in vitro, were found but are likely not to be functional." "The consensus promoter sequences for SP6 and K1-5 differ at positions −10, −11, −12 (Table 2 and Table 3). The SP6 consensus −12G and −10T are not major determinants of promoter activity in vivo or in vitro but any substitution at −11G is inactivating.34 All K1-5 promoters have a pyrimidine at −11, suggesting that SP6 RNAP will not transcribe K1-5 DNA and vice versa. A comparable specificity of the phage RNAP for its cognate promoters is seen throughout the T7 group; for example, T7 RNAP does not recognize T3 promoters and vice versa. However, a single amino acid change in T7 RNAP is sufficient to switch its specificity to T3 promoters, and a change at −11 in a T7 promoter is sufficient to allow its recognition by T3 RNAP.[36.] and [37.] Two changes at positions −9 and −8 of the SP6 promoter to those of a T7 promoter allow recognition by T7 RNAP in vitro.38 All SP6 and most K1-5 promoters have the sequence 5′-GA at these positions, suggesting that the K1-5 genome cannot be transcribed efficiently by T7 RNAP." false false _11_ 0 52 432 Not in stock false n/a false Drew Endy annotation2121047 1 polymerase specificity determinant range2121047 1 6 8 BBa_I20530_sequence 1 atttactggacactatagaagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z