BBa_I22000 1 BBa_I22000 RBS Scaffold with GFP reporter 2007-03-05T12:00:00Z 2015-08-31T04:07:41Z This is a composite part formed from subparts available in the registry. This construct is a scaffold device for measuring RBS strength via GFP fluorescence. The device contains a ccdB expression cassette (BBa_P1010) in place of an RBS. Digestion with AvrII and SapI allows for the insertion of any RBS sequence via Heather Keller's alternative RBS assembly method, which allows for blunt cloning of an RBS upstream of a coding sequence. true false _11_ 0 571 10 Discontinued false Due to the presence of ccdB (BBa_P1010) this device can only be grown in DB3.1 or other permissive strains. false Heather Keller component1920572 1 BBa_P1010 component1920581 1 BBa_B0012 component1920579 1 BBa_B0010 component1920576 1 BBa_E0041 component1920566 1 BBa_S00159 component1920578 1 BBa_B0101 annotation1920578 1 BBa_B0101 range1920578 1 1604 1661 annotation1920576 1 BBa_E0041 range1920576 1 868 1595 annotation1920579 1 BBa_B0010 range1920579 1 1670 1749 annotation1920581 1 BBa_B0012 range1920581 1 1758 1798 annotation1920566 1 BBa_S00159 range1920566 1 1 176 annotation1920572 1 BBa_P1010 range1920572 1 185 859 BBa_E0041 1 BBa_E0041 SapI + GFP 2007-03-05T12:00:00Z 2015-08-31T04:07:25Z The part was generated by PCR amplification of part E0040 with the SapI site incorported into the forward promoter. GFP (mut3) part number E0040 with a unpstream SapI site. Cleave with SapI results in an overhang of 3'-TAC - 5' from the left end of the GFP coding region, making the coding sequence compatible with Heather Keller's alternative assembly method for blunt cloning of RBS sequences upstream of a coding sequence. false false _11_ 0 571 10 Not in stock false n/a false Heather Keller annotation1920210 1 SapI recognition range1920210 1 1 7 annotation1920211 1 BBa_B0102 range1920211 1 1 8 annotation1920212 1 BBa_E0040 range1920212 1 9 728 BBa_S00159 1 BBa_S00159 R0011+B0100+B0048 2007-03-05T12:00:00Z 2015-05-08T01:14:16Z This part was generated by PCR amplification. The upstream biobricks cut sites (EcoRI and XbaI) as well as the R0011 promoter were incorporated into the forward promoter recognizing the ompA region in the MG1655 genome. The AvrII cut site, as well as the downstream biobricks cut sites (SpeI and PstI) were incorporated into the reverse promoter. This part is an intermediate assembly product that contains the R0011 promoter (lambda cI promoter with lacI binding sites), the OmpaA 5' UTR containing a double hairpin for transcript stability, and an AvrII restriction site to facilitate later downstream cloning of an RBS via Heather Keller's RBS characterization scheme. These parts are cloned bluntly, without generating biobricks mixed sites in between. false true _11_ 0 571 10 Not in stock false This part was generated by PCR assembly in order to minimize the number of digestions and ligations necessary to generate a larger construct. Especially given the short sequence of the three individual parts (and the difficulting in purifying small parts) it was much simpler to amplify the product in this way rather than generate the 3 parts individually and clone them together. false Heather Keller annotation1920203 1 ss2 range1920203 1 159 170 annotation1920198 1 lac O1 range1920198 1 26 42 annotation1920199 1 -10 range1920199 1 43 48 annotation1920205 1 AvrII site range1920205 1 171 176 annotation1920204 1 BBa_B0100 range1920204 1 56 170 annotation1920195 1 BBa_R0011 range1920195 1 1 54 annotation1920201 1 ss1 range1920201 1 119 129 annotation1920206 1 BBa_B0048 range1920206 1 171 176 annotation1920196 1 lac O1 range1920196 1 3 19 annotation1920197 1 -35 range1920197 1 20 25 annotation1920200 1 hp1 range1920200 1 56 118 annotation1920202 1 hp2 range1920202 1 130 158 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0101 1 HP3 3 HP3 3 2007-02-28T12:00:00Z 2015-08-31T04:07:21Z The part was made by primer annealing. 3' stabilizing mRNA designed by Christina Smolke and Jay Keasling for stabilizing gfp. false false _11_ 0 571 10 Not in stock false A single base pair change (A to T at position 25) from the original design was made in order to remove a PstI site occurring in the loop of the hairpin. This should have no effect on the secondary structure. false Heather Keller annotation1919685 1 stem_loop range1919685 1 6 58 BBa_P1010 1 ccdB ccdB cell death gene 2004-07-27T11:00:00Z 2015-05-08T01:14:11Z Deleted The ccd operon having a constitutive promoter and the ccdB coding region. ccdB protein is lethal in normal cloning strains. This part is used to aid the process of moving a BioBrick part to a new plasmid. A target plasmid carrying P1010 is cut and mixed with the cut insert. Plasmids that recombine are selected against because they kill the cell that picks them up. P1010 is only provided as plasmid or in DB3.1 which is ccdB resistant. true true _11_1_ 0 60 7 Discontinued false false Leon Chan annotation1747332 1 ccdB (rev) range1747332 1 29 334 annotation1747334 1 T to C mutation range1747334 1 467 467 annotation1747335 1 -10 (rev) range1747335 1 595 600 annotation1747336 1 -35 (rev) range1747336 1 618 623 annotation1747333 1 ccdA- (rev) range1747333 1 336 556 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_P1010_sequence 1 actggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcgt BBa_I22000_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacagccaggggtgctcggcataagccgaagatatcggtagagttaatattgagcagatcccccggtgaaggatttaaccgtgttatctcgttggagatattcatggcgtattttggatcctaggtactagagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcgttactagaggctcttctatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagaggatcgcctgatcccggtgcacccgggcagctgcatagtctgggtgcaccgggatcaggtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0041_sequence 1 gctcttctatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0101_sequence 1 gatcgcctgatcccggtgcacccgggcagctgcatagtctgggtgcaccgggatcagg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_S00159_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacagccaggggtgctcggcataagccgaagatatcggtagagttaatattgagcagatcccccggtgaaggatttaaccgtgttatctcgttggagatattcatggcgtattttggatcctagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z