BBa_I4285 1 BBa_I4285 Trans-splicing Tetrahymena ribozyme to remove LVA tag 2004-10-01T11:00:00Z 2015-08-31T04:07:41Z Tetrahymena thermophila Designed ribozyme to remove LVA tag from constructs built by Reshma containing a LVA tag on the YFP gene. Replace the LVA tag with a stop codon to allow for higher expression. false false _41_ 0 22 7 Not in stock false The ribozyme was designed for trans-splicing based on the design principles in Kohler et al 1999. The target sequence is a EYFP gene with a LVA degradation tag. The target splice site is the U closest to the end of the EYFP. The IGS (P1 helix) of the ribozyme was redesigned to bind to this region and an extended antisense region to the LVA tag of around 50 bp was added. The spliced on 3' exon is simply a stop codon. The expected behavior is for the LVA tag to be replaced by a stop codon, allowing for a return to the normal degradation rate for the protein (i.e. long life) and thus higher expression. <P>Contains the same lac controlled promoter R0011 and double terminator used in the target construct. false Austin Che BBa_I4285_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacaagtgtgactctagtattattaagctactaaagcgtagttttcgtcgtttgcagcggagtacttgtgcagctaaaagttatcaggcatgcacctggtagctagtctttaaaccaatagattgcatcggtttaaaaggcaagaccgtcaaattgcgggaaaggggtcaacagccgttcagtaccaagtctcaggggaaactttgagatggccttgcaaagggtatggtaataagctgacggacatggtcctaaccacgcagccaagtcctaagtcaacagatcttctgttgatatggatgcagttcacagactaaatgtcggtcggggaagatgtattcttctcataagatatagtcggacctctccttaatgggagctagcggatgaagtgatgcaacactggagccgctgggaactaatttgtatgcgaaagtatattgattagttttggagtactcgacaagtaacatcgctcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z