BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2000 1 -35 range2000 1 20 25 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation2001 1 lac O1 range2001 1 26 42 BBa_I5000 1 BBa_I5000 Olmecs: Inducible expression of HK022 cI repressor 2003-11-27T12:00:00Z 2015-08-31T04:07:41Z -- No description -- false false _1_ 0 24 7 It's complicated false false Olmecs 2003 IAP Team component2221075 1 BBa_B0012 component2221071 1 BBa_C0050 component2221079 1 BBa_B0011 component2221068 1 BBa_B0034 component2221062 1 BBa_R0011 annotation2221068 1 BBa_B0034 range2221068 1 64 75 annotation2221071 1 BBa_C0050 range2221071 1 82 825 annotation2221062 1 BBa_R0011 range2221062 1 1 54 annotation2221079 1 BBa_B0011 range2221079 1 908 953 annotation2221075 1 BBa_B0012 range2221075 1 859 899 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_C0050 1 cI HK022 cI repressor from phage HK022 (+LVA?) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage HK022. Released HQ 2013 Coding region for the HK022 bacteriophage cI protein. cI binds to the HK022 pR regulator (BBa_R0050). It represses transcription of the protein encoded by the sequence 3' to the pR region. This coding sequence does not contain a RBS.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Carlson NG, Little JW. Highly cooperative DNA binding by the coliphage HK022 repressor. J Mol Biol. 1993 Apr 20;230(4):1108-30.<br> PMID: 8487297.</P> <P> Mao C, Little JW. Mutations affecting cooperative DNA binding of phage HK022 CI repressor.<br> J Mol Biol. 1998 May 29;279(1):31-48. PMID: 9636698.</P> <p></p> <p></p> <P> References (unparsed) here: <p>Carlson NG, Little JW. Highly cooperative DNA binding by the coliphage HK022 repressor. J Mol Biol. 1993 Apr 20;230(4):1108-30.<br> PMID: 8487297.</P> <P> Mao C, Little JW. Mutations affecting cooperative DNA binding of phage HK022 CI repressor.<br> J Mol Biol. 1998 May 29;279(1):31-48. PMID: 9636698.</P> <p></p> <p></p> <P>Derived from <genbank>STHK022N</genbank>.<br> <br> Response from John Little (Arizona) regarding the start of HK022 cI<br> <br> From: <jlittle@email.arizona.edu> <br> Date: Tue Jan 21, 2003 4:39:21 PM US/Eastern <br> To: "Drew Endy" <endy@MIT.EDU><br> Subject: RE: hk022 cI start (naive question)? <br> Hello Drew and Michael, I seriously doubt that the extra 27 aa are part of CI. It doesn't make sense in terms of the biology, for sure. In any case, the protein we characterized starts where Carlson and Little stated; as I recall, oR3 partially overlaps the start of cI. I have a vague memory of some possibly interesting biology, having to do with multicopy plasmids. I don't recall the findings themselves. Anyway, one possible explanation was that this extra N-terminal addition was made (e.g. from the pRE promoter, or from a message that arose from transcription around the entire plasmid), making a protein with altered functions. We never followed it up. <br> Good luck <br> John<br> <br> -- Original Message -- <br> Date: Sun, 19 Jan 2003 15:26:26 -0500 <br> Subject: hk022 cI start (naive question)? <br> Cc: elowitm@rockefeller.edu <br> To: jlittle@u.arizona.edu <br> From: Drew Endy <endy@MIT.EDU> <br> Hi John, I'm sitting here with Michael Elowitz and we're working through the sequence for HK022 cI. We noticed that the annotation from NC_002166 includes an "extra" 81 base pairs upstream of what we thought of as the actual start. It looks like this extra DNA extends into the PR regulatory region. We're wondering what's going on here? I'm guessing this is well documented somewhere. Thanks for any pointers/info! <br> Drew<P> It is unknown whether there is cross-talk between this repressor and Lambda cI regulatory region, 434 cI regulatory region and P22 regulatory region. true Reshma Shetty annotation1737 1 OR3 partial range1737 1 1 8 annotation1735 1 cI HK022 range1735 1 1 744 annotation1734 1 2 range1734 1 739 744 annotation7033 1 BBa_C0050 range7033 1 1 744 annotation1736 1 SsrA range1736 1 706 738 annotation2213990 1 Help:Barcodes range2213990 1 745 769 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_I5000_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatggttcaacagaaagagcgtgaaactttctcgcagaggcttgcgctggcctgtgataaagcgggattacctttgcatggtaggcaggctgatttagctgtcaggcttaaggtcacaccaaaagccattagtaaatggttcaacggggagtcaataccaagaaaagacaagatggaatctctggcttcggtgctgggaactactgctgcatatctgcatggctatgctgatgatgacggtatcacggtaaatcatctatcaagatcaaatgattattatcgtgttgatgtattggatgttcaggcgagcgccgggccaggaaccatggtttccaatgaatttatagaaaagataagagcaattgaatatacgaccgagcaggcaagaattttatttaatggaaggccacaggaaagcgtaaaagtcatcacggttcgcggtgacagcatggagggaaccatcaatccgggagatgagatctttgttgatgtatccataacctgttttgatggcgatggcatttatgtgtttgtatacgggaaaacaatgcacgttaagcgcctgcaaatgcaaaagaacaggcttgccgtcatctctgacaatgccgcttatgatcgatggtacatagaagaaggtgaagaagagcaacttcacattctagccaaagtcctcattaggcagtcaatcgattacaagcgattcggagctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0050_sequence 1 atggttcaacagaaagagcgtgaaactttctcgcagaggcttgcgctggcctgtgataaagcgggattacctttgcatggtaggcaggctgatttagctgtcaggcttaaggtcacaccaaaagccattagtaaatggttcaacggggagtcaataccaagaaaagacaagatggaatctctggcttcggtgctgggaactactgctgcatatctgcatggctatgctgatgatgacggtatcacggtaaatcatctatcaagatcaaatgattattatcgtgttgatgtattggatgttcaggcgagcgccgggccaggaaccatggtttccaatgaatttatagaaaagataagagcaattgaatatacgaccgagcaggcaagaattttatttaatggaaggccacaggaaagcgtaaaagtcatcacggttcgcggtgacagcatggagggaaccatcaatccgggagatgagatctttgttgatgtatccataacctgttttgatggcgatggcatttatgtgtttgtatacgggaaaacaatgcacgttaagcgcctgcaaatgcaaaagaacaggcttgccgtcatctctgacaatgccgcttatgatcgatggtacatagaagaaggtgaagaagagcaacttcacattctagccaaagtcctcattaggcagtcaatcgattacaagcgattcggagctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccc BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z