BBa_I50010 1 BBa_I50010 oriV origin 2005-12-03T12:00:00Z 2015-08-31T04:07:41Z oriV origin which requires the presence of the RK2-encoded TrfA replication protein (resident on the genome of a host-strain) to be functional. Vector copy number will be 20-50 if this replication origin is active. For this origin to be functional, the strain background must contain the trfA gene. Generally the appropriate strain has a copy-up TrfA mutant protein controlled by the ParaBAD promoter. Thus, L-arabinose can be added to the media to induce expression of the TrfA protein and enable replication at the oriV origin. The origin will not be functional in host strains without this protein. Generally, this origin is used as a secondary, inducible copy number origin in F plasmid based vectors. It allows conditional amplication of the vector copy number when in the appropriate host strain. Similar to part of the pSMART VC sequence from Lucigen http://www.lucigen.com/products/Cloning_Systems/CopyRight.html. It is intended to be combined with other vector components (antibiotic resistance marker, multiple cloning site, a single copy origin like BBa_I50000) in order to form a BioBricks vector. Relevant information can be found at http://openwetware.org/wiki/BioBrick_Parts_for_Plasmid_Engineering. false false _41_6_ 0 126 44 Not in stock false false Reshma Shetty annotation1757858 1 iteron (repeat unit) range1757858 1 199 216 annotation1757864 1 iteron? (repeat unit) range1757864 1 439 456 annotation1757859 1 iteron (repeat unit) range1757859 1 244 261 annotation1757862 1 iteron? (repeat unit) range1757862 1 266 283 annotation1757860 1 iteron (repeat unit) range1757860 1 461 477 annotation1757865 1 iteron? (repeat unit) range1757865 1 178 193 annotation1757863 1 iteron? (repeat unit) range1757863 1 222 238 annotation1757861 1 iteron (repeat unit) range1757861 1 406 420 BBa_I50010_sequence 1 gggttcgagaagggggggcaccccccttcggcgtgcgcggtcacgcgcacagggcgcagccctggttaaaaacaaggtttataaatattggtttaaaagcaggttaaaagacaggttagcggtggccgaaaaacgggcggaaacccttgcaaatgctggattttctgcctgtggacagcccctcaaatgtcaataggtgcgcccctcatctgtcagcactctgcccctcaagtgtcaaggatcgcgcccctcatctgtcagtagtcgcgcccctcaagtgtcaataccgcagggcacttatccccaggcttgtccacatcatctgtgggaaactcgcgtaaaatcaggcgttttcgccgatttgcgaggctggccagctccacgtcgccggccgaaatcgagcctgcccctcatctgtcaacgccgcgccgggtgagtcggcccctcaagtgtcaacgtccgcccctcatctgtcagtgagggccaagttttccgcgaggtatccacaacgccggcggccggccgcggtgtctcgcacacggcttcgacggcgtttctggcgcgtttgcagggccatagacggccgccagcccagcggcgagggcaaccagcccggtgagcgtcgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z