BBa_I50020 1 pUC19 ori Minimal pUC19-derived high copy replication origin 2006-01-09T12:00:00Z 2015-08-31T04:07:41Z High copy origin of replication derived from pSB1A3. Designed to omit antibiotic resistance markers and primer binding sites. false false _41_6_ 0 126 44 Not in stock false false Reshma Shetty annotation1910687 1 G to A, nonfunctional mutation range1910687 1 261 261 annotation1793685 1 RNAII transcript promoter -10 sequence range1793685 1 48 53 annotation1793684 1 RNAI transcript range1793684 1 66 173 annotation1910690 1 C to T, nonfunctional mutation range1910690 1 303 303 annotation1793681 1 RNAII transcript range1793681 1 63 615 annotation1910691 1 C to T, nonfunctional mutation range1910691 1 467 467 annotation1782180 1 rep (pMB1) range1782180 1 16 630 annotation1910688 1 G to A, nonfunctional mutation range1910688 1 265 265 annotation1782181 1 ORI range1782181 1 615 615 annotation1793682 1 RNAI transcript promoter -35 range1793682 1 204 209 annotation1793683 1 RNAI transcript promoter -10 range1793683 1 182 187 annotation1793686 1 RNAII transcript promoter -35 sequence range1793686 1 27 32 annotation1910689 1 G to A, nonfunctional mutation range1910689 1 274 274 annotation1793680 1 origin of replication range1793680 1 27 615 BBa_I50020_sequence 1 cccgtagaaaagatcaaaagatcttcttgagatcctttttttctgcgcgtaatctgctacttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctttagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtagctactgccagtagcgataagtcgtgtcttaccgggttggattcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatctggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z