BBa_I51001 1 BBa_I51001 BioBrick base vector, as revised by Codon Devices 2007-01-29T12:00:00Z 2015-08-31T04:07:42Z This is a composite part generated from several basic parts obtained from a variety of sources. This is a vector scaffold for constructing new BioBricks vectors. Information on the design is available at http://openwetware.org/wiki/Synthetic_Biology:Vectors/pSB%2A%2A5_design true false _41_ 0 126 70 Discontinued false Documented at http://openwetware.org/wiki/Synthetic_Biology:Vectors/pSB%2A%2A5_design Due to technical difficulties during synthesis, rather than including BBa_P1011 as designed, BBa_P1016 was synthesized as a component of this part. Hence, BBa_I51000 documents the original design and BBa_I51001 is the vector scaffold as synthesized. false Reshma Shetty component1910722 1 BBa_B0053 component1910718 1 BBa_P1006 component1910709 1 BBa_G00102 component1910711 1 BBa_B0062 component1910698 1 BBa_B0044 component1910733 1 BBa_B0042 component1910713 1 BBa_B0045 component1910740 1 BBa_G00000 component1910705 1 BBa_B0042 component1910744 1 BBa_P1016 component1910708 1 BBa_B0054 component1910723 1 BBa_G00100 component1910759 1 BBa_I50020 component1910693 1 BBa_G00001 component1910738 1 BBa_B0043 component1910726 1 BBa_B0055 component1910720 1 BBa_B0045 annotation1910733 1 BBa_B0042 range1910733 1 1302 1313 annotation1910726 1 BBa_B0055 range1910726 1 1224 1301 annotation1910759 1 BBa_I50020 range1910759 1 1765 2438 annotation1910705 1 BBa_B0042 range1910705 1 35 46 annotation1910738 1 BBa_B0043 range1910738 1 1314 1326 annotation1910718 1 BBa_P1006 range1910718 1 183 1125 annotation1910723 1 BBa_G00100 range1910723 1 1204 1223 annotation1910693 1 BBa_G00001 range1910693 1 1 21 annotation1910709 1 BBa_G00102 range1910709 1 116 135 annotation1910740 1 BBa_G00000 range1910740 1 1327 1348 annotation1910711 1 BBa_B0062 range1910711 1 136 176 annotation1910744 1 BBa_P1016 range1910744 1 1349 1764 annotation1910722 1 BBa_B0053 range1910722 1 1132 1203 annotation1910708 1 BBa_B0054 range1910708 1 47 115 annotation1910713 1 BBa_B0045 range1910713 1 177 182 annotation1910720 1 BBa_B0045 range1910720 1 1126 1131 annotation1910698 1 BBa_B0044 range1910698 1 22 34 BBa_B0042 1 TSS Translational stop sequence 2006-02-04T12:00:00Z 2015-08-31T04:07:20Z This part contains a stop codon in all 6 reading frames. Useful for ensuring that translation does not proceed through this part. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1797085 1 stop codon (+3 frame) range1797085 1 6 8 annotation1797088 1 stop codon (-3 frame) range1797088 1 5 7 annotation1797083 1 stop codon (+2 frame) range1797083 1 2 4 annotation1797084 1 stop codon (-1 frame) range1797084 1 1 3 annotation1797087 1 stop codon (-2 frame) range1797087 1 9 11 annotation1797086 1 stop codon (+1 frame) range1797086 1 10 12 BBa_B0044 1 TOPO Topoisomerase I mediated cloning site (reverse) 2006-02-04T12:00:00Z 2015-08-31T04:07:20Z Insertion of this site will enable generation of a TOPO vector. The vector will have a T overhang and permit binding of topoisomerase I for direct cloning of PCR products. See http://openwetware.org/wiki/Topoisomerase_I_mediated_TA_cloning for a complete description of Topoisomerase I mediated cloning. This site belongs 3' of the cloning site. It is the reverse complement of BBa_B0043. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1797128 1 Topoisomerase I recognition site range1797128 1 9 13 annotation1797126 1 Nt.BstNB I recognition site range1797126 1 1 5 annotation1797129 1 Generated T overhang range1797129 1 9 9 annotation1797127 1 Arbitrary sequence (could be any bases) range1797127 1 6 8 BBa_B0054 1 BBa_B0054 Transcriptional terminator 2005-11-16T12:00:00Z 2015-08-31T04:07:20Z Terminator to be placed downstream of multiple cloning site in new pSB series plasmids. Similar to BBa_B0051. false false _41_6_ 0 126 44 Not in stock false false Reshma Shetty annotation1783342 1 identical to E. coli MG1655 between tonB and yciA range1783342 1 4 43 annotation1747359 1 stem loop range1747359 1 11 42 BBa_B0055 1 BBa_B0055 -- No description -- 2005-11-16T12:00:00Z 2015-08-31T04:07:20Z Terminator to be placed upstream of multiple cloning site in new pSB series plasmids. false false _41_6_ 0 126 44 Not in stock false false Reshma Shetty annotation1783311 1 identical to bacteriophage T3 range1783311 1 28 66 annotation1783301 1 stem loop from bacteriophage T3 range1783301 1 36 57 BBa_B0053 1 BBa_B0053 Terminator (His) 2004-01-29T12:00:00Z 2015-08-31T04:07:20Z Terminator from the E.coli His operon false true _1_ 0 24 7 Not in stock false false Caitlin Conboy annotation318602 1 stem_loop range318602 1 9 43 BBa_G00102 1 VR Reverse BioBrick primer annealing site (VR binding site) 2006-02-03T12:00:00Z 2015-08-31T04:07:28Z This is the VR sequence to be used in construction of plasmids which include the VR primer site. It is the reverse complement of BBa_G00101. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1961229 1 VR range1961229 1 1 20 BBa_G00001 1 Suffix BioBrick cloning site suffix 2006-03-13T12:00:00Z 2015-08-31T04:07:27Z This part is the standard BioBricks suffix. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1934227 1 PstI range1934227 1 16 21 annotation1821544 1 Suffix range1821544 1 1 21 annotation1934228 1 NotI range1934228 1 9 16 annotation1934226 1 SpeI range1934226 1 2 7 BBa_P1006 1 ampR ampicillin resistance cassette, reverse orientation 2006-02-03T12:00:00Z 2015-05-08T01:14:11Z This contains TetR, a terminator and then AmpR and a terminator false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1897232 1 ampR RBS range1897232 1 869 873 annotation1897233 1 ampR -10 range1897233 1 882 887 annotation1897234 1 ampR -35 range1897234 1 908 913 annotation1897231 1 ampicillin resistance range1897231 1 1 864 BBa_B0045 1 NheI NheI restriction enzyme site (XbaI, SpeI compatible overhang) 2006-03-13T12:00:00Z 2015-08-31T04:07:20Z NheI recognition site. Digestion with NheI generates a compatible cohesive end to XbaI and SpeI. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1822724 1 NheI site range1822724 1 1 6 BBa_G00000 1 Prefix BioBrick cloning site prefix 2006-03-13T12:00:00Z 2015-08-31T04:07:27Z This part is the standard BioBricks prefix. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1934225 1 Prefix range1934225 1 1 22 annotation1934224 1 XbaI site range1934224 1 16 21 annotation1961228 1 NotI site range1961228 1 7 14 annotation1934223 1 EcoRI site range1934223 1 1 6 BBa_I50020 1 pUC19 ori Minimal pUC19-derived high copy replication origin 2006-01-09T12:00:00Z 2015-08-31T04:07:41Z High copy origin of replication derived from pSB1A3. Designed to omit antibiotic resistance markers and primer binding sites. false false _41_6_ 0 126 44 Not in stock false false Reshma Shetty annotation1793685 1 RNAII transcript promoter -10 sequence range1793685 1 48 53 annotation1793683 1 RNAI transcript promoter -10 range1793683 1 182 187 annotation1910690 1 C to T, nonfunctional mutation range1910690 1 303 303 annotation1782180 1 rep (pMB1) range1782180 1 16 630 annotation1910689 1 G to A, nonfunctional mutation range1910689 1 274 274 annotation1793686 1 RNAII transcript promoter -35 sequence range1793686 1 27 32 annotation1793682 1 RNAI transcript promoter -35 range1793682 1 204 209 annotation1793680 1 origin of replication range1793680 1 27 615 annotation1910688 1 G to A, nonfunctional mutation range1910688 1 265 265 annotation1910687 1 G to A, nonfunctional mutation range1910687 1 261 261 annotation1793681 1 RNAII transcript range1793681 1 63 615 annotation1782181 1 ORI range1782181 1 615 615 annotation1793684 1 RNAI transcript range1793684 1 66 173 annotation1910691 1 C to T, nonfunctional mutation range1910691 1 467 467 BBa_G00100 1 VF2 Forward primer for sequencing/amplifying BioBrick parts (VF2) 2004-05-24T11:00:00Z 2015-08-31T04:07:28Z Originally named VF2, primer binds upstream of the standard BBa_MCS on biobrick vectors. false false _11_1_ 0 60 7 Not in stock false false Tom Knight annotation1934505 1 VF2 range1934505 1 1 20 BBa_B0043 1 TOPO Topoisomerase I mediated cloning site (forward) 2006-02-04T12:00:00Z 2015-08-31T04:07:20Z Insertion of this site will enable generation of a TOPO vector. The vector will have a T overhang and permit binding of topoisomerase I for direct cloning of PCR products. See http://openwetware.org/wiki/Topoisomerase_I_mediated_TA_cloning for a complete description of Topoisomerase I mediated cloning. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1797103 1 Arbitrary sequence (could be any bases) range1797103 1 6 8 annotation1797101 1 Topoisomerase I recognition site range1797101 1 1 5 annotation1797102 1 Nt.BstNB I recognition site range1797102 1 9 13 annotation1797104 1 Generated T overhang range1797104 1 5 5 BBa_P1016 1 ccdB ccdB cassette without ccdA- 2007-01-29T12:00:00Z 2015-06-15T01:13:47Z This part is derived from BBa_P1010 but it lacks ccdA-. This part is a differs from BBa_P1011 in that the mutations introduced in BBa_P1011 to remove restriction sites are not present in this part. It does have the "normal" ccd promoter and ccdB coding region. It also has a double TAA stop codon as per BioBrick conventions. true false _41_ 4206 126 70 Not in stock false ccdA- was eliminated since it is an inactive form of ccdA and should not be required for the toxic phenotype of ccdB. false Reshma Shetty annotation1910684 1 -35 range1910684 1 41 46 annotation1910686 1 ccdB range1910686 1 108 416 annotation1910685 1 -10 range1910685 1 64 69 BBa_B0062 1 BBa_B0062 Terminator (Reverse B0052) 2004-01-29T12:00:00Z 2015-08-31T04:07:21Z Reverse of B0052, E.coli transcriptional terminator from the ribosomal RNA rrnC operon. false false _1_ 0 24 7 Not in stock false false Caitlin Conboy annotation318637 1 stem_loop range318637 1 14 33 BBa_I51001_sequence 1 tactagtagcggccgctgcaggagtcactaagggttagttagttagattagcagaaagtcaaaagcctccgaccggaggcttttgactaaaacttcccttggggttatcattggggctcactcaaaggcggtaatcagataaaaaaaatccttagctttcgctaaggatgatttctgctagcttattaccaatgcttaatcagggaggcacctatctcagcgatctggcgattacgttcgtccatagttgcctggctccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagggctgcaataataccgcgggacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagcgagagtaagaagttcgccagttaagagtttgcgcaacgttgttgccatagctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcacccatgttgtgcaaaaaagcggtaagctccttcggtcctccgatcgttgtcagaagtaagttggccgccgtgttatcactcatggttatggcagcgctgcataattcgcgtactgtcatgccgtccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacagagcagaactttaaaagtgctcatcattgggaaacgttcttcggggcgaaaactctcaagaatcttaccgctgttgaggtccagttcgatgtaacccacacgtgcacccaactgatcttcggcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatattcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatagatatttgaatgtatttaggctagctccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgtttgccacctgacgtctaagaaaaggaatattcagcaatttgcccgtgccgaagaaaggcccacccgtgaaggtgagccagtgagttgattgctacgtaattagttagttagcccttagtgactcgaattcgcggccgcttctagagggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataacccgtagaaaagatcaaaagatcttcttgagatcctttttttctgcgcgtaatctgctacttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctttagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtagctactgccagtagcgataagtcgtgtcttaccgggttggattcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatctggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat BBa_I50020_sequence 1 cccgtagaaaagatcaaaagatcttcttgagatcctttttttctgcgcgtaatctgctacttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctttagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtagctactgccagtagcgataagtcgtgtcttaccgggttggattcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatctggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat BBa_B0045_sequence 1 gctagc BBa_B0062_sequence 1 cagataaaaaaaatccttagctttcgctaaggatgatttct BBa_P1016_sequence 1 ggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataa BBa_B0055_sequence 1 aaggaatattcagcaatttgcccgtgccgaagaaaggcccacccgtgaaggtgagccagtgagttgattgctacgtaa BBa_B0044_sequence 1 gagtcactaaggg BBa_B0042_sequence 1 ttagttagttag BBa_B0054_sequence 1 attagcagaaagtcaaaagcctccgaccggaggcttttgactaaaacttcccttggggttatcattggg BBa_G00000_sequence 1 gaattcgcggccgcttctagag BBa_G00001_sequence 1 tactagtagcggccgctgcag BBa_B0053_sequence 1 tccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgtt BBa_G00100_sequence 1 tgccacctgacgtctaagaa BBa_P1006_sequence 1 ttattaccaatgcttaatcagggaggcacctatctcagcgatctggcgattacgttcgtccatagttgcctggctccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagggctgcaataataccgcgggacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagcgagagtaagaagttcgccagttaagagtttgcgcaacgttgttgccatagctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcacccatgttgtgcaaaaaagcggtaagctccttcggtcctccgatcgttgtcagaagtaagttggccgccgtgttatcactcatggttatggcagcgctgcataattcgcgtactgtcatgccgtccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacagagcagaactttaaaagtgctcatcattgggaaacgttcttcggggcgaaaactctcaagaatcttaccgctgttgaggtccagttcgatgtaacccacacgtgcacccaactgatcttcggcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatattcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatagatatttgaatgtatttag BBa_G00102_sequence 1 gctcactcaaaggcggtaat BBa_B0043_sequence 1 cccttagtgactc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z