BBa_G00100 1 VF2 Forward primer for sequencing/amplifying BioBrick parts (VF2) 2004-05-24T11:00:00Z 2015-08-31T04:07:28Z Originally named VF2, primer binds upstream of the standard BBa_MCS on biobrick vectors. false false _11_1_ 0 60 7 Not in stock false false Tom Knight annotation1934505 1 VF2 range1934505 1 1 20 BBa_I50022 1 pUC19 ori Minimal pUC19-derived high copy replication origin 2008-01-05T12:00:00Z 2015-08-31T04:07:42Z pSB1A3 High copy origin of replication derived from pSB1A3. Designed to omit antibiotic resistance markers and primer binding sites. Lacks mutations that render BBa_I50020 nonfunctional as a replication origin. false false _41_ 0 126 162 Not in stock false We had to leave several restriction sites in because point mutations that eliminated these sites were found to render the origin nonfunctional. false Reshma Shetty annotation1959125 1 ORI range1959125 1 615 615 annotation1959122 1 RNAI transcript range1959122 1 66 173 annotation1959124 1 RNAI transcript promoter -35 range1959124 1 204 209 annotation1959117 1 rep (pMB1) range1959117 1 16 630 annotation1959118 1 RNAII transcript promoter -35 sequence range1959118 1 27 32 annotation1959119 1 origin of replication range1959119 1 27 615 annotation1959123 1 RNAI transcript promoter -10 range1959123 1 182 187 annotation1959121 1 RNAII transcript range1959121 1 63 615 annotation1959120 1 RNAII transcript promoter -10 sequence range1959120 1 48 53 BBa_G00000 1 Prefix BioBrick cloning site prefix 2006-03-13T12:00:00Z 2015-08-31T04:07:27Z This part is the standard BioBricks prefix. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1934225 1 Prefix range1934225 1 1 22 annotation1934223 1 EcoRI site range1934223 1 1 6 annotation1934224 1 XbaI site range1934224 1 16 21 annotation1961228 1 NotI site range1961228 1 7 14 BBa_I51020 1 BB base ve BioBrick base vector (for constructing pSB**5 vectors) 2008-01-05T12:00:00Z 2015-08-31T04:07:42Z This is a composite part generated from several basic parts obtained from a variety of sources. This is a vector scaffold for constructing new BioBricks vectors. Information on the design is available at http://openwetware.org/wiki/Synthetic_Biology:Vectors/pSB%2A%2A5_design true false _41_ 0 126 162 Discontinued false Documented at http://openwetware.org/wiki/Synthetic_Biology:Vectors/pSB%2A%2A5_design Due to technical difficulties during synthesis, rather than including BBa_P1011 as designed, BBa_P1016 was synthesized as a component of this part. Hence, BBa_I51000 documents the original design and BBa_I51001 is the vector scaffold as synthesized. BBa_I52002 is the base vector as corrected from the synthesized construct. true Reshma Shetty component1959233 1 BBa_B0045 component1959225 1 BBa_B0042 component1959218 1 BBa_B0044 component1959229 1 BBa_G00102 component1959238 1 BBa_P1006 component1959244 1 BBa_G00100 component1959231 1 BBa_B0062 component1959277 1 BBa_I50022 component1959240 1 BBa_B0045 component1959242 1 BBa_B0053 component1959213 1 BBa_G00001 component1959254 1 BBa_B0042 component1959247 1 BBa_B0055 component1959259 1 BBa_B0043 component1959263 1 BBa_G00000 component1959267 1 BBa_P1016 component1959228 1 BBa_B0054 annotation1959259 1 BBa_B0043 range1959259 1 1314 1326 annotation1959218 1 BBa_B0044 range1959218 1 22 34 annotation1959231 1 BBa_B0062 range1959231 1 136 176 annotation1959242 1 BBa_B0053 range1959242 1 1132 1203 annotation1959277 1 BBa_I50022 range1959277 1 1765 2438 annotation1959225 1 BBa_B0042 range1959225 1 35 46 annotation1959244 1 BBa_G00100 range1959244 1 1204 1223 annotation1959229 1 BBa_G00102 range1959229 1 116 135 annotation1959263 1 BBa_G00000 range1959263 1 1327 1348 annotation1959254 1 BBa_B0042 range1959254 1 1302 1313 annotation1959247 1 BBa_B0055 range1959247 1 1224 1301 annotation1959238 1 BBa_P1006 range1959238 1 183 1125 annotation1959267 1 BBa_P1016 range1959267 1 1349 1764 annotation1959240 1 BBa_B0045 range1959240 1 1126 1131 annotation1959213 1 BBa_G00001 range1959213 1 1 21 annotation1959228 1 BBa_B0054 range1959228 1 47 115 annotation1959233 1 BBa_B0045 range1959233 1 177 182 BBa_G00001 1 Suffix BioBrick cloning site suffix 2006-03-13T12:00:00Z 2015-08-31T04:07:27Z This part is the standard BioBricks suffix. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1934226 1 SpeI range1934226 1 2 7 annotation1934228 1 NotI range1934228 1 9 16 annotation1821544 1 Suffix range1821544 1 1 21 annotation1934227 1 PstI range1934227 1 16 21 BBa_B0042 1 TSS Translational stop sequence 2006-02-04T12:00:00Z 2015-08-31T04:07:20Z This part contains a stop codon in all 6 reading frames. Useful for ensuring that translation does not proceed through this part. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1797083 1 stop codon (+2 frame) range1797083 1 2 4 annotation1797085 1 stop codon (+3 frame) range1797085 1 6 8 annotation1797088 1 stop codon (-3 frame) range1797088 1 5 7 annotation1797084 1 stop codon (-1 frame) range1797084 1 1 3 annotation1797087 1 stop codon (-2 frame) range1797087 1 9 11 annotation1797086 1 stop codon (+1 frame) range1797086 1 10 12 BBa_P1006 1 ampR ampicillin resistance cassette, reverse orientation 2006-02-03T12:00:00Z 2015-05-08T01:14:11Z This contains TetR, a terminator and then AmpR and a terminator false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1897231 1 ampicillin resistance range1897231 1 1 864 annotation1897233 1 ampR -10 range1897233 1 882 887 annotation1897232 1 ampR RBS range1897232 1 869 873 annotation1897234 1 ampR -35 range1897234 1 908 913 BBa_B0044 1 TOPO Topoisomerase I mediated cloning site (reverse) 2006-02-04T12:00:00Z 2015-08-31T04:07:20Z Insertion of this site will enable generation of a TOPO vector. The vector will have a T overhang and permit binding of topoisomerase I for direct cloning of PCR products. See http://openwetware.org/wiki/Topoisomerase_I_mediated_TA_cloning for a complete description of Topoisomerase I mediated cloning. This site belongs 3' of the cloning site. It is the reverse complement of BBa_B0043. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1797126 1 Nt.BstNB I recognition site range1797126 1 1 5 annotation1797128 1 Topoisomerase I recognition site range1797128 1 9 13 annotation1797127 1 Arbitrary sequence (could be any bases) range1797127 1 6 8 annotation1797129 1 Generated T overhang range1797129 1 9 9 BBa_B0054 1 BBa_B0054 Transcriptional terminator 2005-11-16T12:00:00Z 2015-08-31T04:07:20Z Terminator to be placed downstream of multiple cloning site in new pSB series plasmids. Similar to BBa_B0051. false false _41_6_ 0 126 44 Not in stock false false Reshma Shetty annotation1783342 1 identical to E. coli MG1655 between tonB and yciA range1783342 1 4 43 annotation1747359 1 stem loop range1747359 1 11 42 BBa_B0045 1 NheI NheI restriction enzyme site (XbaI, SpeI compatible overhang) 2006-03-13T12:00:00Z 2015-08-31T04:07:20Z NheI recognition site. Digestion with NheI generates a compatible cohesive end to XbaI and SpeI. false true _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1822724 1 NheI site range1822724 1 1 6 BBa_B0043 1 TOPO Topoisomerase I mediated cloning site (forward) 2006-02-04T12:00:00Z 2015-08-31T04:07:20Z Insertion of this site will enable generation of a TOPO vector. The vector will have a T overhang and permit binding of topoisomerase I for direct cloning of PCR products. See http://openwetware.org/wiki/Topoisomerase_I_mediated_TA_cloning for a complete description of Topoisomerase I mediated cloning. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1797102 1 Nt.BstNB I recognition site range1797102 1 9 13 annotation1797103 1 Arbitrary sequence (could be any bases) range1797103 1 6 8 annotation1797104 1 Generated T overhang range1797104 1 5 5 annotation1797101 1 Topoisomerase I recognition site range1797101 1 1 5 BBa_G00102 1 VR Reverse BioBrick primer annealing site (VR binding site) 2006-02-03T12:00:00Z 2015-08-31T04:07:28Z This is the VR sequence to be used in construction of plasmids which include the VR primer site. It is the reverse complement of BBa_G00101. false false _41_6_ 0 126 45 Not in stock false false Reshma Shetty annotation1961229 1 VR range1961229 1 1 20 BBa_P1016 1 ccdB ccdB cassette without ccdA- 2007-01-29T12:00:00Z 2015-06-15T01:13:47Z This part is derived from BBa_P1010 but it lacks ccdA-. This part is a differs from BBa_P1011 in that the mutations introduced in BBa_P1011 to remove restriction sites are not present in this part. It does have the "normal" ccd promoter and ccdB coding region. It also has a double TAA stop codon as per BioBrick conventions. true false _41_ 4206 126 70 Not in stock false ccdA- was eliminated since it is an inactive form of ccdA and should not be required for the toxic phenotype of ccdB. false Reshma Shetty annotation1910684 1 -35 range1910684 1 41 46 annotation1910685 1 -10 range1910685 1 64 69 annotation1910686 1 ccdB range1910686 1 108 416 BBa_B0053 1 BBa_B0053 Terminator (His) 2004-01-29T12:00:00Z 2015-08-31T04:07:20Z Terminator from the E.coli His operon false true _1_ 0 24 7 Not in stock false false Caitlin Conboy annotation318602 1 stem_loop range318602 1 9 43 BBa_B0055 1 BBa_B0055 -- No description -- 2005-11-16T12:00:00Z 2015-08-31T04:07:20Z Terminator to be placed upstream of multiple cloning site in new pSB series plasmids. false false _41_6_ 0 126 44 Not in stock false false Reshma Shetty annotation1783311 1 identical to bacteriophage T3 range1783311 1 28 66 annotation1783301 1 stem loop from bacteriophage T3 range1783301 1 36 57 BBa_B0062 1 BBa_B0062 Terminator (Reverse B0052) 2004-01-29T12:00:00Z 2015-08-31T04:07:21Z Reverse of B0052, E.coli transcriptional terminator from the ribosomal RNA rrnC operon. false false _1_ 0 24 7 Not in stock false false Caitlin Conboy annotation318637 1 stem_loop range318637 1 14 33 BBa_I50022_sequence 1 cccgtagaaaagatcaaaagatcttcttgagatcctttttttctgcgcgtaatctgctacttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctttagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat BBa_I51020_sequence 1 tactagtagcggccgctgcaggagtcactaagggttagttagttagattagcagaaagtcaaaagcctccgaccggaggcttttgactaaaacttcccttggggttatcattggggctcactcaaaggcggtaatcagataaaaaaaatccttagctttcgctaaggatgatttctgctagcttattaccaatgcttaatcagggaggcacctatctcagcgatctggcgattacgttcgtccatagttgcctggctccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagggctgcaataataccgcgggacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagcgagagtaagaagttcgccagttaagagtttgcgcaacgttgttgccatagctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcacccatgttgtgcaaaaaagcggtaagctccttcggtcctccgatcgttgtcagaagtaagttggccgccgtgttatcactcatggttatggcagcgctgcataattcgcgtactgtcatgccgtccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacagagcagaactttaaaagtgctcatcattgggaaacgttcttcggggcgaaaactctcaagaatcttaccgctgttgaggtccagttcgatgtaacccacacgtgcacccaactgatcttcggcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatattcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatagatatttgaatgtatttaggctagctccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgtttgccacctgacgtctaagaaaaggaatattcagcaatttgcccgtgccgaagaaaggcccacccgtgaaggtgagccagtgagttgattgctacgtaattagttagttagcccttagtgactcgaattcgcggccgcttctagagggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataacccgtagaaaagatcaaaagatcttcttgagatcctttttttctgcgcgtaatctgctacttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggctttagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat BBa_B0045_sequence 1 gctagc BBa_B0062_sequence 1 cagataaaaaaaatccttagctttcgctaaggatgatttct BBa_P1016_sequence 1 ggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataa BBa_B0055_sequence 1 aaggaatattcagcaatttgcccgtgccgaagaaaggcccacccgtgaaggtgagccagtgagttgattgctacgtaa BBa_B0044_sequence 1 gagtcactaaggg BBa_B0042_sequence 1 ttagttagttag BBa_B0054_sequence 1 attagcagaaagtcaaaagcctccgaccggaggcttttgactaaaacttcccttggggttatcattggg BBa_G00000_sequence 1 gaattcgcggccgcttctagag BBa_G00001_sequence 1 tactagtagcggccgctgcag BBa_B0053_sequence 1 tccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgtt BBa_G00100_sequence 1 tgccacctgacgtctaagaa BBa_P1006_sequence 1 ttattaccaatgcttaatcagggaggcacctatctcagcgatctggcgattacgttcgtccatagttgcctggctccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagggctgcaataataccgcgggacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagcgagagtaagaagttcgccagttaagagtttgcgcaacgttgttgccatagctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcacccatgttgtgcaaaaaagcggtaagctccttcggtcctccgatcgttgtcagaagtaagttggccgccgtgttatcactcatggttatggcagcgctgcataattcgcgtactgtcatgccgtccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacagagcagaactttaaaagtgctcatcattgggaaacgttcttcggggcgaaaactctcaagaatcttaccgctgttgaggtccagttcgatgtaacccacacgtgcacccaactgatcttcggcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatattcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatagatatttgaatgtatttag BBa_G00102_sequence 1 gctcactcaaaggcggtaat BBa_B0043_sequence 1 cccttagtgactc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z