BBa_E0032 1 YFP enhanced yellow fluorescent protein derived from A. victoria GFP 2003-01-31T12:00:00Z 2015-08-31T04:07:25Z Modified from <bb_part>BBa_E0031</bb_part> Released HQ 2013 Yellow fluorescent protein (EYFP) reporter coding sequence without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. </P> Annotated mutation cause a Q81L mutation that appears to not be near the active site. </P> false false _1_ 0 24 7 In stock false <P> <P>BBa_E0032 yellow fluorescent protein is based on BioBrick part BBa_E0031. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation2159 1 2 range2159 1 757 762 annotation7041 1 BBa_E0032 range7041 1 1 762 annotation2156 1 YFP (LVA) range2156 1 1 762 annotation2160 1 SsrA range2160 1 718 756 annotation2161 1 A (Q->L) range2161 1 242 242 BBa_I6061 1 BBa_I6061 Promoter O_H Test R0011.E0432 2004-03-16T12:00:00Z 2015-08-31T04:07:43Z -- No description -- false false _1_ 0 24 7 It's complicated false From: randy@rwald.com<br> Subject: Part BBa_I6061 does not work<br> Date: August 20, 2004 6:23:01 PM EDT<br> To: endy@mit.edu<br> Cc: endelman@caltech.edu, ryhsiao@uiuc.edu<br> <br> Hi,<br> <br> Because our team was using reporter E0432 to test some of our parts, we decided to conduct a lab test of this part (using the I6061 construct). We found that the I6061 construct (with pMB1 origin and amp resistance), when transformed into the MC4100 strain of E. coli, does not fluoresce. More specifically, we examined the culture on a single-cell level and found that about 1 in 50 cells showed fluorescence, despite the strain's high copy number. For comparison, the I6031 construct, when placed in the same plasmid and strain, glowed brightly enough on the colony level so as to not require a single-cell examination. In any event, information to this effect should be added to the BioBricks database, and perhaps the status of the part should be changed from "Issues" to "Fails." Unless you have more information regarding what sorts of issues those were.<br> <br> Sincerely,<br> <br> Randall Wald<br> false Caitlin Conboy and Jennifer Braff component2221246 1 BBa_R0011 component2221264 1 BBa_E0432 annotation2221246 1 BBa_R0011 range2221246 1 1 54 annotation2221264 1 BBa_E0432 range2221264 1 64 980 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_E0432 1 BBa_E0432 EYFP (RBS+ LVA+ TERM) (B0034.E0032.B0015) 2003-12-04T12:00:00Z 2015-08-31T04:07:26Z Released HQ 2013 -- No description -- false true _1_ 0 24 7 In stock false false Caitlin Conboy and Jennifer Braff component942938 1 BBa_B0012 component942928 1 BBa_B0010 component942908 1 BBa_B0034 component942920 1 BBa_E0032 annotation942928 1 BBa_B0010 range942928 1 789 868 annotation942908 1 BBa_B0034 range942908 1 1 12 annotation942938 1 BBa_B0012 range942938 1 877 917 annotation942920 1 BBa_E0032 range942920 1 19 780 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2002 1 -10 range2002 1 43 48 annotation2001 1 lac O1 range2001 1 26 42 annotation2000 1 -35 range2000 1 20 25 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation1999 1 lac O1 range1999 1 3 19 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I6061_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_E0032_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_E0432_sequence 1 aaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z