BBa_I6078 1 BBa_I6078 Promoter O_H Test R1050.E0432 2004-03-17T12:00:00Z 2015-08-31T04:07:43Z false false _1_ 0 24 7 It's complicated false false Caitlin Conboy and Jennifer Braff component949418 1 BBa_B0010 component949428 1 BBa_B0012 component949388 1 BBa_R1050 component949410 1 BBa_E0032 component949398 1 BBa_B0034 annotation949428 1 BBa_B0012 range949428 1 941 981 annotation949410 1 BBa_E0032 range949410 1 83 844 annotation949398 1 BBa_B0034 range949398 1 65 76 annotation949418 1 BBa_B0010 range949418 1 853 932 annotation949388 1 BBa_R1050 range949388 1 1 56 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_E0032 1 YFP enhanced yellow fluorescent protein derived from A. victoria GFP 2003-01-31T12:00:00Z 2015-08-31T04:07:25Z Modified from <bb_part>BBa_E0031</bb_part> Released HQ 2013 Yellow fluorescent protein (EYFP) reporter coding sequence without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. </P> Annotated mutation cause a Q81L mutation that appears to not be near the active site. </P> false false _1_ 0 24 7 In stock false <P> <P>BBa_E0032 yellow fluorescent protein is based on BioBrick part BBa_E0031. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation2159 1 2 range2159 1 757 762 annotation2161 1 A (Q->L) range2161 1 242 242 annotation7041 1 BBa_E0032 range7041 1 1 762 annotation2160 1 SsrA range2160 1 718 756 annotation2156 1 YFP (LVA) range2156 1 1 762 BBa_R1050 1 cI HK022 Promoter, Standard (HK022 cI regulated) <br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z Bacteriophage HK022. Released HQ 2013 [Note: This is the same part as R0050 except that the -10 and -35 sites and spacing have been changed to comply with BBa_S0001].<br><br> The pR regulatory region is a 98 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two operator sites at which HK022 cI protein can bind cooperatively. The -35 and -10 regions from pR are included along with some flanking sequences. The cutoff for the 5' end of the regulatory region was placed just after the pM -10 region which promotes transcription of a gene upstream (thus the pM -10 region is not included). The cutoff for the 3' end of the regulatory region was placed immediately prior to the RBS. </p> false false _1_ 0 24 7 In stock false <P> <P>Derived from <genbank>STHK022N</genbank>.<br> Modified to comply with BBa_S0001:<br> TTGACA-17N-GATACT<br><P> Literature claims that there is no cross-talk between HK022 cI regulatory region, Lambda cI, 434 cI and P22 cI, but this has not been verified experimentally by the synthetic biology group at MIT. true Reshma Shetty, Drew Endy annotation2065 1 -35 range2065 1 8 14 annotation2066 1 OR2 range2066 1 14 28 annotation2067 1 OR1 range2067 1 38 52 annotation2071 1 -10 range2071 1 31 36 annotation7073 1 BBa_R1050 range7073 1 1 56 annotation2070 1 putative range2070 1 44 44 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I6078_sequence 1 ttaggtattgacatgtactatcagttccgtgatactatgaaccataagttcaccactactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R1050_sequence 1 ttaggtattgacatgtactatcagttccgtgatactatgaaccataagttcaccac BBa_B0034_sequence 1 aaagaggagaaa BBa_E0032_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z