BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_I711000 1 BBa_I711000 tyrosinase (mel) gene 2007-05-25T11:00:00Z 2015-08-31T04:07:45Z s. antibioticus The nucleotide sequence of the tyrosinase gene from Streptomyces antibioticus and characterization of the gene product false false _158_ 0 1496 9 Not in stock false Only one part of 2 needed for production of melanin false Ron Bauerle annotation1933732 1 our start site range1933732 1 1 4 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_I711001 1 BBa_I711001 generates the tyrosinase for melanin biosynthesis 2007-05-25T11:00:00Z 2015-08-31T04:07:45Z Registry promoter, RBS, and terminator. this is the generator for tyrosinase gene Constitutive promoter false false _158_ 0 1496 9 Not in stock false no design considerations false Ron Bauerle component1933862 1 BBa_B0011 component1933858 1 BBa_B0012 component1933852 1 BBa_J23119 component1933857 1 BBa_I711000 component1933854 1 BBa_B0030 annotation1933854 1 BBa_B0030 range1933854 1 44 58 annotation1933858 1 BBa_B0012 range1933858 1 898 938 annotation1933852 1 BBa_J23119 range1933852 1 1 35 annotation1933862 1 BBa_B0011 range1933862 1 947 992 annotation1933857 1 BBa_I711000 range1933857 1 65 889 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0030_sequence 1 attaaagaggagaaa BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_I711000_sequence 1 atgaccgtccgcaagaaccaggcgtccctgaccgccgaggagaagcgccgcttcgtcgccgccctgctcgaactcaagcgcaccggccgctacgacgccttcgtcaccacgcacaacgcgttcatcctgggcgacaccgacaacggcgagcgcaccggccaccgttcgccgtccttcctgccctggcaccgcagatttctgctggagttcgagcgggcgctccagtcggtggacgcgtcggtggcgctgccgtactgggactggtccgccgaccggtccacccggtcctcgctgtgggcgccggacttcctcggcggcaccgggcgcagccgggacggccaggtgatggacgggccgttcgccgcgtcggccggcaactggccgatcaatgtgcgggtggacggccgtacgttcctgcggcgggcgctcggcgcgggcgtgagcgaactgcccacgcgtgccgaggtcgactcggtgctggcgatggcgacgtacgacatggcgccctggaacagcggctccgacggcttccgcaaccatctcgaagggtggcgcggggtcaatctgcacaaccgggtgcatgtctgggtcggcggccagatggcgaccggggtctcccccaacgacccggtgttctggctgcaccacgcctacatcgacaagctgtgggccgagtggcagcggcggcacccctcgtccccgtatctgccgggcggcggcacgccgaacgtcgtcgacctcaacgagacgatgaagccgtggaacgacaccaccccggcggccctgctggaccacacccggcactacaccttcgacgtctaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I711001_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagattaaagaggagaaatactagatgaccgtccgcaagaaccaggcgtccctgaccgccgaggagaagcgccgcttcgtcgccgccctgctcgaactcaagcgcaccggccgctacgacgccttcgtcaccacgcacaacgcgttcatcctgggcgacaccgacaacggcgagcgcaccggccaccgttcgccgtccttcctgccctggcaccgcagatttctgctggagttcgagcgggcgctccagtcggtggacgcgtcggtggcgctgccgtactgggactggtccgccgaccggtccacccggtcctcgctgtgggcgccggacttcctcggcggcaccgggcgcagccgggacggccaggtgatggacgggccgttcgccgcgtcggccggcaactggccgatcaatgtgcgggtggacggccgtacgttcctgcggcgggcgctcggcgcgggcgtgagcgaactgcccacgcgtgccgaggtcgactcggtgctggcgatggcgacgtacgacatggcgccctggaacagcggctccgacggcttccgcaaccatctcgaagggtggcgcggggtcaatctgcacaaccgggtgcatgtctgggtcggcggccagatggcgaccggggtctcccccaacgacccggtgttctggctgcaccacgcctacatcgacaagctgtgggccgagtggcagcggcggcacccctcgtccccgtatctgccgggcggcggcacgccgaacgtcgtcgacctcaacgagacgatgaagccgtggaacgacaccaccccggcggccctgctggaccacacccggcactacaccttcgacgtctaataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z