BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_I711005 1 BBa_I711005 Melanogenesis with red light trigger 2007-06-04T11:00:00Z 2015-08-31T04:07:45Z S. antibiotica This part is triggered by BBa_1711006 (which detects red light) and produces tyrosinase and ORF438, two proteins known to be important for melanogenesis. false false _158_ 0 1498 9 Not in stock false The promoter region may have to be modified to be activated by BBa_I711006. false VGEM 2007 component1934546 1 BBa_I711004 component1934551 1 BBa_B0011 component1934544 1 BBa_B0030 component1934542 1 BBa_R0084 component1934547 1 BBa_B0012 annotation1934551 1 BBa_B0011 range1934551 1 1490 1535 annotation1934546 1 BBa_I711004 range1934546 1 138 1432 annotation1934544 1 BBa_B0030 range1934544 1 117 131 annotation1934542 1 BBa_R0084 range1934542 1 1 108 annotation1934547 1 BBa_B0012 range1934547 1 1441 1481 BBa_R0084 1 OmpR Promoter (OmpR, positive) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z NC_000913 E. coli K12 Released HQ 2013 Positively regulated, OmpR-controlled promoter. This promoter is taken from the upstream region of ompF. Phosphorylated OmpR binds to the three operator sites and activates transcription. false false _1_ 0 24 7 In stock false The promoter includes three OmpR binding sites: F1, F2, and F3. The promoter starts at -107 and goes up to the transcriptional start site at +1. A distant fourth binding site, F4, has been deleted. It is involved in negative regulation of ompF (Head, Tardy and Kenney, 1998), so its deletion is intended to make the promoter solely activating. The efficacy of this promoter versus the ompC upstream region (BBa_R0082) or the truncated ompC upstream region (BBa_R0083) is currently unknown. true Stephen Lee, Roshan Kumar, Joe Levine, Ziyan Chu (Polkadorks, IAP 2004) annotation301313 1 F3 OmpR range301313 1 51 68 annotation301309 1 F2 OmpR range301309 1 31 48 annotation301317 1 -35 range301317 1 73 78 annotation301308 1 F1 OmpR range301308 1 11 28 annotation301318 1 -10 range301318 1 88 93 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_I711004 1 BBa_I711004 Generates tyrosinase (mel) and ORF438 for melanogenesis 2007-06-04T11:00:00Z 2015-08-31T04:07:45Z S. antibiotica The nucleotide sequence of the tyrosinase gene (mel) and an upstream ORF from S.antibioticus. From the paper titled Melanin Production in Escherichia Coli from a Cloned Tyrosinase Gene by Bernan,V., Filpula,D., Herber,W., Bibb,M. and Katz,E. false false _158_ 0 1498 9 Not in stock false None false VGEM 2007 BBa_I711005_sequence 1 cttaaattttacttttggttacatattttttctttttgaaaccaaatctttatctttgtagcactttcacggtagcgaaacgttagtttgaatggaaagatgcctgcatactagagattaaagaggagaaatactagatgccggaactcacccgtcgtcgcgcgctcggcgccgcagccgtcgtcgccgccggtgtcccgctggtcgcccttcccgccgcccgcgcggacgatcgggggcaccacacccccgaggtccccgggaacccggccgcgtccggcgcccccgccgccttcgacgagatctacaagggccgccggatacagggccggacggtcaccgacggcgggggccaccacggcggcggtcacggcggtgacggtcacggcggcggccatcacggcggcggttacgccgtgttcgtggacggcgtcgaactgcatgtgatgcgcaacgccgacggctcgtggatcagcgtcgtcagccactacgagccggtggacaccccgcgcgccgcggcccgcgctgcggtcgacgagctccagggcgcccggctcctccccttcccctccaactgaccttctcccccgcacttttggagcacccgcacatgaccgtccgcaagaaccaggcgtccctgaccgccgaggagaagcgccgcttcgtcgccgccctgctcgaactcaagcgcaccggccgctacgacgccttcgtcaccacgcacaacgcgttcatcctgggcgacaccgacaacggcgagcgcaccggccaccgttcgccgtccttcctgccctggcaccgcagatttctgctggagttcggcgggcgctccagtcggtggacgcgtcggtggcgctgccgtactgggactggtccgcgaccggtccacccggtcctcgctgtgggcgccggacttcctcggcggcaccgggcgcagccgggacggccaggtgatggacgggccgttcgccgcgtcggccggcaactggccgatcaatgtgcgggtggacggccgtacgttcctgcggcgggcgctcggcgcgggcgtgagcgaactgcccacgcgtgccgaggtcgactcggtgctggcgatggcgacgtacgacatggcgccctggaacagcggctccgacggcttccgcaaccatctcgaagggtggccggggtcaatctgcacaaccgggtgcatgtctgggtcggcggccagatggcgaccggggtctcccccaacgacccggtgttctggctgcaccacgcctacatcgacaagctgtgggccgagtggcagcggcggcacccctcgtccccgtatctgccgggcggcggcacgccgaacgtcgtcgacctcaacgagacgatgaagccgtggaacgacaccaccccggcggccctgctggaccacacccggcactacaccttcgacgtctgatcatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_I711004_sequence 1 atgccggaactcacccgtcgtcgcgcgctcggcgccgcagccgtcgtcgccgccggtgtcccgctggtcgcccttcccgccgcccgcgcggacgatcgggggcaccacacccccgaggtccccgggaacccggccgcgtccggcgcccccgccgccttcgacgagatctacaagggccgccggatacagggccggacggtcaccgacggcgggggccaccacggcggcggtcacggcggtgacggtcacggcggcggccatcacggcggcggttacgccgtgttcgtggacggcgtcgaactgcatgtgatgcgcaacgccgacggctcgtggatcagcgtcgtcagccactacgagccggtggacaccccgcgcgccgcggcccgcgctgcggtcgacgagctccagggcgcccggctcctccccttcccctccaactgaccttctcccccgcacttttggagcacccgcacatgaccgtccgcaagaaccaggcgtccctgaccgccgaggagaagcgccgcttcgtcgccgccctgctcgaactcaagcgcaccggccgctacgacgccttcgtcaccacgcacaacgcgttcatcctgggcgacaccgacaacggcgagcgcaccggccaccgttcgccgtccttcctgccctggcaccgcagatttctgctggagttcggcgggcgctccagtcggtggacgcgtcggtggcgctgccgtactgggactggtccgcgaccggtccacccggtcctcgctgtgggcgccggacttcctcggcggcaccgggcgcagccgggacggccaggtgatggacgggccgttcgccgcgtcggccggcaactggccgatcaatgtgcgggtggacggccgtacgttcctgcggcgggcgctcggcgcgggcgtgagcgaactgcccacgcgtgccgaggtcgactcggtgctggcgatggcgacgtacgacatggcgccctggaacagcggctccgacggcttccgcaaccatctcgaagggtggccggggtcaatctgcacaaccgggtgcatgtctgggtcggcggccagatggcgaccggggtctcccccaacgacccggtgttctggctgcaccacgcctacatcgacaagctgtgggccgagtggcagcggcggcacccctcgtccccgtatctgccgggcggcggcacgccgaacgtcgtcgacctcaacgagacgatgaagccgtggaacgacaccaccccggcggccctgctggaccacacccggcactacaccttcgacgtctgatca BBa_B0030_sequence 1 attaaagaggagaaa BBa_R0084_sequence 1 cttaaattttacttttggttacatattttttctttttgaaaccaaatctttatctttgtagcactttcacggtagcgaaacgttagtttgaatggaaagatgcctgca BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z