BBa_I712008 1 HA HA affinity tag 2007-10-19T11:00:00Z 2015-08-31T04:07:45Z Part was constructed by primer annealing. HA-tag is used for detection of HA-tagged proteins by anti-HA antibodies. false false _130_ 0 1846 9 It's complicated false Gene was designed to be constructed by primer annealing. Includes start codon. false Anja Korenčič BBa_I712008_sequence 1 atgtacccctacgacgtgcccgactacgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z