BBa_I712009 1 CD4 signal CD4 signal peptide; localizes to plasma membrane 2007-10-21T11:00:00Z 2015-08-31T04:07:45Z It comes from human gene for CD4 receptor. Coding region for first 25 amino acids (including start codon) of CD4 receptor which is signal peptide for plasma membrane localization. false false _130_ 0 1850 9 In stock false No considerations. true Peter Cimermancic BBa_I712009_sequence 1 atgaaccggggagtcccttttaggcacttgcttctggtgctgcaactggcgctcctcccagcagccactcaggga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z