BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z