BBa_I714000 1 BBa_I714000 R388 oriT ( transfer origin of E.coli IncW group R388 plasmid) 2007-05-29T11:00:00Z 2015-08-31T04:07:47Z NCBI nucleotide sequence database, REGION: 15948..16349 of ACCESSION BR000038 The transfer origin of plasmid R388 which belongs to the incompatible group IncW. A plasmid carrying oriT will be able to transfer to other bacteria cells by conjugation if the other R388 gene products are present in the same cell. It has both initiation and termination activities of the rolling cycle replication of plasmid conjugative transfer. false false _142_ 0 1480 9 Not in stock false The sequence information is from Genbank. We are trying to get the physical DNA. false Yang Yifan BBa_I714000_sequence 1 ccgcctcgtcctccaaaagtgcctgcttttccgggcttagccgtacttggatggggtcgcctagtgccatgtcctctcccgtagtgttactgtagtggttcaatcctagcatttacaaggggttgcggcaatattgtagtggcataacactacacaggttttcgtccttggcgtggaagtcattgtaaatcaatgacttacgcgcaccgaaaggtgcgtattgtctatagcccagatttaaggataccaacccggcttttaaggacggaaaccatgcgataacgccagcgtgaccctaaagagggtcaaaactgctcccaatgcgctatgcgcattgggttatcgtgcagcaatgatgcaactataatgctatgatggtgctacaatgatgcagaaaatgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z