BBa_I714003 1 BBa_I714003 minimum oriT of plasmid R64 ( origin of transfer, R64 is IncI-1 ) 2007-05-29T11:00:00Z 2015-08-31T04:07:47Z Sequence information from NCBI nucleotide sequence database ACCESSION AB027308 REGION: 53798..53880 Origin of transfer of plasmid R64 of IncI-1 incompatible group. A plasmid containing it can be transfered to other cells if the R64 conjugative genes are present in the same cell. It has both initiation and termination activities of the rolling cycle replication. false false _142_ 0 1480 9 Not in stock false We do not have the physical DNA yet. Trying to get the whole R64 plasmid false Yang Yifan BBa_I714003_sequence 1 ggggtgtcggggcgaagccctgaccagatggcaattgtaatagcgtcgcgtgtgacggtattacaattgcacatcctgtcccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z