BBa_I714030 1 BBa_I714030 OriT-F (Origin of Transfer for the F-plasmid nic region) 2007-10-19T11:00:00Z 2015-08-31T04:07:47Z Origin-of-transfer nic region excised from Plasmid F genomic DNA.(NCBI:AP001918) OriT-F (Origin of Transfer for the F-type conjugative plasmid) is the nic region, where the relaxosome nicks the plasmid and conjugative transfer by F plasmid machinery begins via rolling circle replication. false false _142_ 0 2248 9 In stock false This OriT-F is the same as the host cell's native Origin of Transfer, Please compare the sequence with J01002. true Mingzhi Qu BBa_I714030_sequence 1 cctctggtgactttatccgtaaataatttaacccactccacaaaaaggctcaacaggttggtggttctcaccaccaaaagcaccacaccccacgcaaaaacaagtttttgctgatttttctttataaatagagtgttatgaaaaattagtttctcttactctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaacgcgccgacaccgttttgtaggggtggtactgactatttttataaaaaacattattttatattaggggtgctgctagcggcgcggtgtgtttttttataggataccgctaggggcgctgctagcggtgcgtccctgtttgcattatgaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z