BBa_I714031 1 BBa_I714031 OriT-R (Origin of Transfer for the R751-plasmid nic region) 2007-10-20T11:00:00Z 2015-08-31T04:07:47Z Enterobacter aerogenes plasmid R751 NCBI:NC_001735 Released HQ 2013 OriT-R751 (Origin of Transfer for the R751-type conjugative plasmid) is the nic region, where the relaxosome nicks the plasmid and conjugative transfer by R751 plasmid machinery begins via rolling circle replication. false false _142_ 0 2248 9 In stock false true Mingzhi Qu BBa_I714031_sequence 1 gatctcgtctttctcttcggggaacaccggcacccgcaggtgctgccgccgccggcggccgtgttccttttcgtcgttctccatgcctcgcctcgtctctcatgccggcggtagccggctgcctcgcagagcaggatgacccgttgagcgcccccggcgcgaataagggacagtgaagatagataaccggctcgccggttagctaacttcacacatcctgcccgccttacggcgttaataacaccaaggaaagtctacaccagccattacgatttatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z