BBa_I714032 1 BBa_I714032 OriT-S (Origin of Transfer for the pSC101-plasmid nic region) 2007-10-20T11:00:00Z 2015-08-31T04:07:47Z pSC101 NCBI:NC_002056 OriT-S (Origin of Transfer for the pSC101-type conjugative plasmid) is the nic region, where the relaxosome nicks the plasmid and conjugative transfer by pSC101 plasmid machinery begins via rolling circle replication. false false _142_ 0 2248 9 It's complicated false false Mingzhi Qu BBa_I714032_sequence 1 tttacgctgagatgataggatgccatcgtgttttatcccgctgaagggcgcacgtttctgaacgaagtgaagaaagtctaagtgcgccctgataaataaaagagttatcagggattgtagtgggatttgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z