BBa_I714044 1 BBa_I714044 [R0010][I714031] 2007-10-20T11:00:00Z 2015-08-31T04:07:47Z [R0010]+[I714031] Released HQ 2013 This is I714031 with R0010 Promoter in the front. false false _142_ 0 2248 9 In stock false false Mingzhi Qu component1951661 1 BBa_I714031 component1951654 1 BBa_R0010 annotation1951654 1 BBa_R0010 range1951654 1 1 200 annotation1951661 1 BBa_I714031 range1951661 1 209 486 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961225 1 -10 range1961225 1 161 166 annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961226 1 LacI binding site range1961226 1 166 200 BBa_I714031 1 BBa_I714031 OriT-R (Origin of Transfer for the R751-plasmid nic region) 2007-10-20T11:00:00Z 2015-08-31T04:07:47Z Enterobacter aerogenes plasmid R751 NCBI:NC_001735 Released HQ 2013 OriT-R751 (Origin of Transfer for the R751-type conjugative plasmid) is the nic region, where the relaxosome nicks the plasmid and conjugative transfer by R751 plasmid machinery begins via rolling circle replication. false false _142_ 0 2248 9 In stock false true Mingzhi Qu BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_I714044_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagaggatctcgtctttctcttcggggaacaccggcacccgcaggtgctgccgccgccggcggccgtgttccttttcgtcgttctccatgcctcgcctcgtctctcatgccggcggtagccggctgcctcgcagagcaggatgacccgttgagcgcccccggcgcgaataagggacagtgaagatagataaccggctcgccggttagctaacttcacacatcctgcccgccttacggcgttaataacaccaaggaaagtctacaccagccattacgatttatc BBa_I714031_sequence 1 gatctcgtctttctcttcggggaacaccggcacccgcaggtgctgccgccgccggcggccgtgttccttttcgtcgttctccatgcctcgcctcgtctctcatgccggcggtagccggctgcctcgcagagcaggatgacccgttgagcgcccccggcgcgaataagggacagtgaagatagataaccggctcgccggttagctaacttcacacatcctgcccgccttacggcgttaataacaccaaggaaagtctacaccagccattacgatttatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z