BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 BBa_I714032 1 BBa_I714032 OriT-S (Origin of Transfer for the pSC101-plasmid nic region) 2007-10-20T11:00:00Z 2015-08-31T04:07:47Z pSC101 NCBI:NC_002056 OriT-S (Origin of Transfer for the pSC101-type conjugative plasmid) is the nic region, where the relaxosome nicks the plasmid and conjugative transfer by pSC101 plasmid machinery begins via rolling circle replication. false false _142_ 0 2248 9 It's complicated false false Mingzhi Qu BBa_I714046 1 BBa_I714046 [R0010][I714032] 2007-10-20T11:00:00Z 2015-08-31T04:07:48Z [R0010]+[I714032] This is I714032 with R0010 Promoter in the front. false false _142_ 0 2248 9 Not in stock false false Mingzhi Qu component1951681 1 BBa_I714032 component1951674 1 BBa_R0010 annotation1951681 1 BBa_I714032 range1951681 1 209 339 annotation1951674 1 BBa_R0010 range1951674 1 1 200 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_I714032_sequence 1 tttacgctgagatgataggatgccatcgtgttttatcccgctgaagggcgcacgtttctgaacgaagtgaagaaagtctaagtgcgccctgataaataaaagagttatcagggattgtagtgggatttgac BBa_I714046_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagtttacgctgagatgataggatgccatcgtgttttatcccgctgaagggcgcacgtttctgaacgaagtgaagaaagtctaagtgcgccctgataaataaaagagttatcagggattgtagtgggatttgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z