BBa_J23008 1 BBa_J23008 [key3c] riboregulator for lock3 variants 2006-07-09T11:00:00Z 2015-08-31T04:08:38Z J23007 This part has the same homology region to J01122 as J23007 except that unlike J23007, J23008 does not contain the hairpin that was derived from J01129. J23008 anneals linearly to the stem of the hairpin in J01122 with perfect base pairing and destroys the hairpin in the process and reveals the RBS on J01122. When J01122 is transcribed the RNA secondary structure is such that the RBS hairpins with sequence upstream preventing the ribosome from binding and translation from occuring thereby locking up RFP further down stream. When J23008 is introduced into the cell in trans, we suspect that it will unlock the RBS for RFP as described above allowing translation to occur. false false _52_ 0 931 52 In stock false No design considerations true Kaitlin Davis BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_I714051 1 BBa_I714051 [I714030][J23066][I714030] 2007-10-19T11:00:00Z 2015-08-31T04:07:48Z [I714030] + [J23066] + [I714030] This is a tandem I714030(OriT-F) with J23066(key) in the middle. false false _142_ 0 2248 9 It's complicated false false Mingzhi Qu component1951283 1 BBa_I714030 component1951274 1 BBa_I714030 component1951277 1 BBa_B0010 component1951276 1 BBa_J23009 component1951275 1 BBa_J23008 component1951279 1 BBa_B0012 annotation1951277 1 BBa_B0010 range1951277 1 571 650 annotation1951283 1 BBa_I714030 range1951283 1 708 1062 annotation1951275 1 BBa_J23008 range1951275 1 364 457 annotation1951279 1 BBa_B0012 range1951279 1 659 699 annotation1951276 1 BBa_J23009 range1951276 1 466 562 annotation1951274 1 BBa_I714030 range1951274 1 1 355 BBa_I714030 1 BBa_I714030 OriT-F (Origin of Transfer for the F-plasmid nic region) 2007-10-19T11:00:00Z 2015-08-31T04:07:47Z Origin-of-transfer nic region excised from Plasmid F genomic DNA.(NCBI:AP001918) OriT-F (Origin of Transfer for the F-type conjugative plasmid) is the nic region, where the relaxosome nicks the plasmid and conjugative transfer by F plasmid machinery begins via rolling circle replication. false false _142_ 0 2248 9 In stock false This OriT-F is the same as the host cell's native Origin of Transfer, Please compare the sequence with J01002. true Mingzhi Qu BBa_J23009 1 BBa_J23009 [key3d] riboregulator for lock3 variants 2006-08-02T11:00:00Z 2015-08-31T04:08:38Z Overlap extension Variant of key3 (see part J01129 (key3), J23007(key3b), J23008(key3c)). Part is in pJ23006, so there is a Ptet upstream of the XbaI site to drive expression. Nevertheless, J23009 is still a basic part allowing both prefix and suffix insertions. false false _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I714051_sequence 1 cctctggtgactttatccgtaaataatttaacccactccacaaaaaggctcaacaggttggtggttctcaccaccaaaagcaccacaccccacgcaaaaacaagtttttgctgatttttctttataaatagagtgttatgaaaaattagtttctcttactctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaacgcgccgacaccgttttgtaggggtggtactgactatttttataaaaaacattattttatattaggggtgctgctagcggcgcggtgtgtttttttataggataccgctaggggcgctgctagcggtgcgtccctgtttgcattatgaattactagagacccaaaagcaagaggtgattctagttggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctttactagagcgggcgggcgggcgggcgggatccataaaaaaaaaacccaaaagcaagaggtgattctagttaaaaaaaaaaagcttcccgcccgcccgcccgcccgtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagcctctggtgactttatccgtaaataatttaacccactccacaaaaaggctcaacaggttggtggttctcaccaccaaaagcaccacaccccacgcaaaaacaagtttttgctgatttttctttataaatagagtgttatgaaaaattagtttctcttactctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaacgcgccgacaccgttttgtaggggtggtactgactatttttataaaaaacattattttatattaggggtgctgctagcggcgcggtgtgtttttttataggataccgctaggggcgctgctagcggtgcgtccctgtttgcattatgaat BBa_J23008_sequence 1 acccaaaagcaagaggtgattctagttggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_J23009_sequence 1 cgggcgggcgggcgggcgggatccataaaaaaaaaacccaaaagcaagaggtgattctagttaaaaaaaaaaagcttcccgcccgcccgcccgcccg BBa_I714030_sequence 1 cctctggtgactttatccgtaaataatttaacccactccacaaaaaggctcaacaggttggtggttctcaccaccaaaagcaccacaccccacgcaaaaacaagtttttgctgatttttctttataaatagagtgttatgaaaaattagtttctcttactctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaacgcgccgacaccgttttgtaggggtggtactgactatttttataaaaaacattattttatattaggggtgctgctagcggcgcggtgtgtttttttataggataccgctaggggcgctgctagcggtgcgtccctgtttgcattatgaat BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z