BBa_J23078 1 BBa_J23078 [lock3i] 2006-09-12T11:00:00Z 2015-08-31T04:08:39Z <tt> PCR ca1028F/G00101 on pJ23006-J23032 . . . (162 bp, XbaI/PstI)<br> Sub into pSB1A2-I13521 . . . . . . . . . . (XbaI/PstI)<br> Product is pSB1A2-J23078<br> </tt> lock3d derivative with a 5' extension. This is the basic part, J23077 is the RFP reporter. false true _52_ 0 483 95 It's complicated false N/A false John Anderson BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_I714070 1 BBa_I714070 [R0040][J23078] ([pTet][Lock3]) 2007-10-20T11:00:00Z 2015-08-31T04:07:48Z [R0040]+[J23078] This is J23078(lock3d derivative with a 5' extension) with R0040 Promoter in the front. false false _142_ 0 2248 9 It's complicated false true Mingzhi Qu component1951744 1 BBa_J23078 component1951740 1 BBa_R0040 annotation1951744 1 BBa_J23078 range1951744 1 63 114 annotation1951740 1 BBa_R0040 range1951740 1 1 54 BBa_I714070_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtgtagaccgaactagaatcacctcttgcttttgggtaagacagaagaggaga BBa_J23078_sequence 1 tgtagaccgaactagaatcacctcttgcttttgggtaagacagaagaggaga BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z