BBa_I714072 1 BBa_I714072 [R0040][I714033] 2007-10-21T11:00:00Z 2015-08-31T04:07:48Z [R0040] + [I714033] Released HQ 2013 This is I714033(crRNA-lock3-var1) with R0040 Promoter in the front. true false _142_ 0 2248 9 Discontinued false false Mingzhi Qu annotation1952085 1 -10 range1952085 1 43 48 annotation1952083 1 -35 range1952083 1 20 25 annotation1952084 1 TetR 2 range1952084 1 26 44 annotation1952081 1 TetR 1 range1952081 1 1 19 annotation1952082 1 BBa_R0040 range1952082 1 1 54 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 BBa_I714072_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z