##gff-version 3 ##sequence-region BBa_R0010 1 200 ##sequence-region BBa_I714076 1 200 BBa_R0010 . non_covalent_binding_site 89 126 . + 0 ID=annotation1961223;Name=CAP binding site BBa_R0010 . promoter 161 166 . + 0 ID=annotation1961225;Name=-10 BBa_R0010 . non_covalent_binding_site 166 200 . + 0 ID=annotation1961226;Name=LacI binding site BBa_R0010 . engineered_region 1 200 . + 0 ID=annotation1961222;Name=BBa_R0010 BBa_R0010 . CDS 1 88 . + 0 ID=annotation1961221;Name=end of LacI coding region (inactive) BBa_R0010 . promoter 137 142 . + 0 ID=annotation1961224;Name=-35 BBa_R0010 . start_codon 173 173 . + 0 ID=annotation1961227;Name=start BBa_I714076 . promoter 161 166 . + 0 ID=annotation1952140;Name=-10 BBa_I714076 . start_codon 173 173 . + 0 ID=annotation1952142;Name=start BBa_I714076 . non_covalent_binding_site 166 200 . + 0 ID=annotation1952141;Name=LacI binding site BBa_I714076 . promoter 137 142 . + 0 ID=annotation1952139;Name=-35 BBa_I714076 . CDS 1 88 . + 0 ID=annotation1952137;Name=end of LacI coding region (inactive) BBa_I714076 . non_covalent_binding_site 89 126 . + 0 ID=annotation1952138;Name=CAP binding site BBa_I714076 . engineered_region 1 200 . + 0 ID=annotation1952136;Name=BBa_R0010 >BBa_R0010 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagc gggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggct cgtatgttgtgtggaattgtgagcggataacaatttcacaca >BBa_I714076 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagc gggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggct cgtatgttgtgtggaattgtgagcggataacaatttcacaca